View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11869_low_13 (Length: 208)

Name: NF11869_low_13
Description: NF11869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11869_low_13
NF11869_low_13
[»] chr2 (1 HSPs)
chr2 (20-199)||(34095466-34095645)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 34095466 - 34095645
Alignment:
20 gttctaacgttggtgctggatggattgtgcctaacaatcacaatcagaatcagaataacattaacaacagggttgttgttggtggcggtaactatggatc 119  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||    
34095466 gttctaacgttggtgctggatggattgtgcctaacaatcagaatcagaatcagaataacattaaaaacagggttgttgttggtggtggtaactatggatc 34095565  T
120 tggttcactactttgtagtagtagaaacccttttgagccttctaaagagctctcttcaatgccaaatcttcttctctctc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||    
34095566 tggttcactactttgtagtagtagaaacccttttgagccttctaaagagctctcttcaatgccaaatcttcatcactctc 34095645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University