View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11869_low_13 (Length: 208)
Name: NF11869_low_13
Description: NF11869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11869_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 34095466 - 34095645
Alignment:
| Q |
20 |
gttctaacgttggtgctggatggattgtgcctaacaatcacaatcagaatcagaataacattaacaacagggttgttgttggtggcggtaactatggatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34095466 |
gttctaacgttggtgctggatggattgtgcctaacaatcagaatcagaatcagaataacattaaaaacagggttgttgttggtggtggtaactatggatc |
34095565 |
T |
|
| Q |
120 |
tggttcactactttgtagtagtagaaacccttttgagccttctaaagagctctcttcaatgccaaatcttcttctctctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
34095566 |
tggttcactactttgtagtagtagaaacccttttgagccttctaaagagctctcttcaatgccaaatcttcatcactctc |
34095645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University