View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11869_low_9 (Length: 277)
Name: NF11869_low_9
Description: NF11869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11869_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 72 - 264
Target Start/End: Complemental strand, 5137757 - 5137565
Alignment:
| Q |
72 |
ggcattactaaatgttatttgttttgcttaattgttcctctaacaatgaaagaataactaaaacaaaatttactgttttcnnnnnnnncttgtcagcttt |
171 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
5137757 |
ggcattactaaatgttatttgttttccttaattgttcctctaacaatgaaagaataactaaaataaaatttactgttttcataaaaaacttgtcagcttt |
5137658 |
T |
|
| Q |
172 |
ccttaaattaaaatagcttcttagtacactagtatggatggcaacatgttggtcctcatctgttatttgaattaatagctagcctaccatgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5137657 |
ccttaaattaaaatagcttcttagtacactagtatggatggcaacatgttggtcctcatctgttctttgaattaatagctagcctaccatgat |
5137565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University