View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_2 (Length: 886)
Name: NF11870_high_2
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 8438431 - 8438719
Alignment:
| Q |
1 |
tgataacaacacgtcgtctctgctggagatgcagattagaagagggtcctacacgagaatgaattttaggtagagaagaaggaagggaatgaagggtagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8438431 |
tgataacaacacgtcgtctctgctggagatgcagattagaagagggtcctacccgagaataaattttaggtatagaagaaggaagggaatgaagggtagg |
8438530 |
T |
 |
| Q |
101 |
gaatgaaattggtatagaagggattgagggtttgcatatgaaattgattgtagccatcggagaagagaaagcagagaaacaagagttggaggagattggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438531 |
gaatgaaattggtatagaagggattgagggtttgcatatgaaattgattgtagccatcggagaagagaaagcagagaaacaagagttggaggagattggg |
8438630 |
T |
 |
| Q |
201 |
aaagaagagtatgggaa-tgataaaaaatcatatcctctttgcttaattcatatgtggtacttattcaccacacgtgtcttttcatttt |
288 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438631 |
aaagaagagtatgggaattgataaaaaatcatatcctctttgcttaattcatatgtggtacttattcaccacacgtgtcttttcatttt |
8438719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University