View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_30 (Length: 310)
Name: NF11870_high_30
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 295
Target Start/End: Original strand, 2624297 - 2624581
Alignment:
| Q |
11 |
cagagaagagcctcggattagagaacaagatttcggtattgaataattaattaactaattcaaaagtttttctacctagtttagttttctgtcttgtata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2624297 |
cagagaagagcctcggattagagaacaagatttcggtattgaataattaattaactaattcaaaagtttttctacctaatttagttttctgtcttgtata |
2624396 |
T |
 |
| Q |
111 |
ttggtatgttctcaaatttatttattgtttctttgtgatttatgttatgtaagggaattttcaaaatagagagttgatgaaagttgaaaaagcgcaacgc |
210 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624397 |
ttgatatgttctcaaatttatttattgtttctttgtgatttatgttatgtaagggaattttcaaaatagagagttgatgaaagttgaaaaagcgcaacgc |
2624496 |
T |
 |
| Q |
211 |
catctttatggtcgtttcttttaccgatttccaaatggtgaatctgcggctgatgtatacgatagaatcacaggtagcaattttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624497 |
catctttatggtcgtttcttttaccgatttccaaatggtgaatctgcggctgatgtatacgatagaatcacaggtagcaattttt |
2624581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University