View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_32 (Length: 285)
Name: NF11870_high_32
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 20 - 270
Target Start/End: Original strand, 14988149 - 14988395
Alignment:
| Q |
20 |
gtcaagtctttgaaggtgataagcctttcaagtttcagtctcatcgtcctactattgttcttcttgatcgtggaggtattgnnnnnnnnnnnnnnnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14988149 |
gtcaagtctttgaaggtgataagcctttcaagtttcagtctcatcgtcctactattgttcttcttgatcgtggaggtattgcttttttcttctttgtttt |
14988248 |
T |
 |
| Q |
120 |
nnagtcaaccttggttatcgttgactttatttaattagtgtgtgtaggctttgtctgcttcatattttattcacctgcacatgctaattaaatgttttgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14988249 |
ttagtcaaccttggttatcgttgactttatttaattagtgt----aggctttgtctgcttcatattttattcacctgcacatgctaatttaatgttttgc |
14988344 |
T |
 |
| Q |
220 |
ttttttgattctgtttaattttactgttacataaattaatgtctgttctgt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14988345 |
ttttttgattctgtttaattttactgttacataaattaatgtctgttctgt |
14988395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University