View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_34 (Length: 273)
Name: NF11870_high_34
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 23 - 263
Target Start/End: Original strand, 24224877 - 24225117
Alignment:
| Q |
23 |
ggttccttccgtcaattgcttggtagaaacaaattagagaaactgggaacgtgatgtttgcttcgaaatggtaatttgcaacattccactaattggtatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224877 |
ggttccttccgtcaattgcttggtagaaacaaattagagaaattgggaacatgatgtttgcttcgaaatggtaatttgcaacattccactaattggtatt |
24224976 |
T |
 |
| Q |
123 |
atttctttggatttttagattcacggtgtgcatattgtttggatggttttgagcacgttttgaaattaattgcatcaatcatcaatattttggattttag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224977 |
atttctttggatttttagattcacggtgtgcatattgtttggatggttttgagcacgttttgaaattaattgcatcaatcatcaatattttggattttag |
24225076 |
T |
 |
| Q |
223 |
agacgtagaagttattctttcaccgtggtatttacttgttt |
263 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24225077 |
agacgtagaagttattctttcaccatggtatttacttgttt |
24225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University