View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_35 (Length: 263)
Name: NF11870_high_35
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 23 - 138
Target Start/End: Complemental strand, 50831125 - 50831010
Alignment:
| Q |
23 |
tgggcttttagaaactgcatgacattaccttgaattacagtgttcttaatatttcagtagtaccgttctaagtgtcgaaggctatgtagccaagtcaaag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| | ||||| |||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
50831125 |
tgggcttttagaaactgcatgacattaccttcaattacagtgtccttaatatttcggaagtacggttcaaagtgtcgatggctatgtcgccaagtcaaag |
50831026 |
T |
|
| Q |
123 |
acggaggggagtgctt |
138 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
50831025 |
accaaggggagtgctt |
50831010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University