View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_51 (Length: 238)
Name: NF11870_high_51
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 47028348 - 47028573
Alignment:
| Q |
1 |
attggtttgaattgaatttatcatatttacgcagtgatccatccatata---ttgtataaaagaaaactcctttggttaaaatggaagttggaatattgg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47028348 |
attggtttgaattgaatttatcatatttacgcagtgatccatccatattggtttgaataacccctg-ctcctttggttaaaatggaagttggaatattgg |
47028446 |
T |
|
| Q |
98 |
agttggacctctaccagttgttcaagaatactagtctctttatctttgtcaa-ttatcaaatcaagcaagaagatggcatcacgagtaatgtcttttatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47028447 |
agttggacctctaccagttgttcaagaatactagtctctttatctttgtcaatttatcaaatcaagcaagaagatggcatcacgagtaatgtcttttatc |
47028546 |
T |
|
| Q |
197 |
ttattatagataatcaggggtggttct |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47028547 |
ttattatagataatcaggggtggttct |
47028573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University