View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_high_54 (Length: 230)
Name: NF11870_high_54
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_high_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 3338353 - 3338164
Alignment:
| Q |
24 |
acaaagggcatctttggatgcatgggttttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338353 |
acaaagggcatctttggatgcatgggttttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattat |
3338254 |
T |
|
| Q |
124 |
tatcactaattaattttaggtaggtttcagagatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338253 |
tatcactaattaattttaggtaggtttcagagatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg |
3338164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University