View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_33 (Length: 323)
Name: NF11870_low_33
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_33 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 24 - 323
Target Start/End: Complemental strand, 10663261 - 10662962
Alignment:
| Q |
24 |
gcaaatgaggttattgatcagaaggaggtggttagtaacataaaagctatgtcgtgacgttgggggttaaatatatggaacatgtctcattgcctcagaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10663261 |
gcaaatgaggttattgatcagaaggaggtggttagtaacataaaagctatgtcgtggcgttgggggttaaatatatggaacatgtctcattgcctcagaa |
10663162 |
T |
 |
| Q |
124 |
ttgtctgatttaatacctgtgtttttcgatcattttctgctatttcggactggtttttctggtgcagggaacttgaggtttctgtctagaggtaagtggt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10663161 |
ttgtctgatttaatacctgtgtttttcgatcattttctgctatttcggactggtttttctggtgcagggaacttgaggtttctgtcttgaggtaagtggt |
10663062 |
T |
 |
| Q |
224 |
ggctggattatgatttggtgcggttagtcctcgggttattggagcagcggtttgatggtttcttttggctataggtgttatggcgttctttcttagaatt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10663061 |
ggctggattatgatttggtgcggttagtcctcgggttattggaacagcggtttgatggtttcttttggctataggtgttatggtgttctttcttagaatt |
10662962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University