View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_35 (Length: 312)
Name: NF11870_low_35
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 296
Target Start/End: Complemental strand, 32702027 - 32701743
Alignment:
| Q |
14 |
atcacgtatatattaagtatatat--taagaatgaaactttataattcatgataggtttctctgctcagtttctttgattgatgtgcagcgaaaccttaa |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702027 |
atcacgtatatattaagtatatatattaagaatgaaactttataattcatgataggtttctctgctcagtttctttgattgatgtgcagcgaaaccttaa |
32701928 |
T |
|
| Q |
112 |
agatgaacatcacccaagttgctgcaaccaatcctgcaatttatgtcacaataaaatatcagccacgccgcttggattgtcaatgaatgccaaccctctc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32701927 |
agatgaacatcacccaagttgctgcaaccaatcctgcaatttatgtcacaaaaaaatatcagccacgccgcttggattgtcaatgaatgccaaccctctc |
32701828 |
T |
|
| Q |
212 |
tctagcagcttcataatcccaagagcaaaaccatcatctggcttagaatgtgttaggcagagtgcggtcactgccccgacattaa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32701827 |
tctagcagcttcataatcccaagagcaaaaccatcatctggcttagaatgtgttaggcagagtgcggtcactgccccgacattaa |
32701743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 185 - 288
Target Start/End: Complemental strand, 3957779 - 3957676
Alignment:
| Q |
185 |
ggattgtcaatgaatgccaaccctctctctagcagcttcataatcccaagagcaaaaccatcatctggcttagaatgtgttaggcagagtgcggtcactg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||| |||||||||||||||||| |||||||||||| | |||||||||||||| ||| ||||| |
|
|
| T |
3957779 |
ggattgtcaatgaatgccaaccctctctctaggaccttcctaatcccaagagcaaaactttcatctggcttatattgtgttaggcagagcgcgaccactg |
3957680 |
T |
|
| Q |
285 |
cccc |
288 |
Q |
| |
|
|||| |
|
|
| T |
3957679 |
cccc |
3957676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 177
Target Start/End: Complemental strand, 3957871 - 3957803
Alignment:
| Q |
109 |
taaagatgaacatcacccaagttgctgcaaccaatcctgcaatttatgtcacaataaaatatcagccac |
177 |
Q |
| |
|
||||||||||| || |||||||||||||| ||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
3957871 |
taaagatgaacgccatccaagttgctgcaagtaatcctgcaatttatgtcaggaaaaactatcagccac |
3957803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University