View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_47 (Length: 245)
Name: NF11870_low_47
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 10663392 - 10663614
Alignment:
| Q |
8 |
gatgaatatatatttccaccatatcaatatattatgttatcttaaatgtagattatttaatattatcctgtttgtatatatgtttttctgagnnnnnnnc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
10663392 |
gatgaatatatatttccaccatatcaatatattatgttatcttaaatgtagattatttaatattatgctgtttgtatatatgtttttctgagtttttttc |
10663491 |
T |
 |
| Q |
108 |
ctttgtgtgtataatgaagtaatggagtctaagtcaatatccatcttcatttggccaaatccgcattatgtttattgttaaactaaaaatagtttattca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10663492 |
ctttgtgtgtataatgaagtaatggagtctaagtcaatatccatcttcatttggccaaaaccgcattatgtttattgttaaactaaaaatagtttattca |
10663591 |
T |
 |
| Q |
208 |
ccatacttctgacatgcatgagt |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10663592 |
ccatacttctgacatgcatgagt |
10663614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University