View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_51 (Length: 240)
Name: NF11870_low_51
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 10988000 - 10988221
Alignment:
| Q |
1 |
tcatcactttcgtgcttctctctccctctcgctggtgttggcgccggtgcttccctttccgttcatacagcagcggcagtgcctatacatgattattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10988000 |
tcatcactttcgtgcttctctctccctctcgctggtgctggcgccggtgcttccctttccgttcatacagcggcggcagtgcctatacatgattattttc |
10988099 |
T |
 |
| Q |
101 |
catggtagattccatcatacaagtaactgaaattaatagttgaatacaaatcaaattgttttagtcttgacatactcattcggtgaatcaaaatttaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10988100 |
catggtagattccatcatacaagtaactgaaattaatagttgaatacaaatcaaattgttttagtcttgacatactcattcggtgaatcaaaatttaatt |
10988199 |
T |
 |
| Q |
201 |
gttggtgcaacgttgagtagtc |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10988200 |
tttggtgcaacgttgagtagtc |
10988221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10990946 - 10990903
Alignment:
| Q |
1 |
tcatcactttcgtgcttctctctccctctcgctggtgttggcgc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
10990946 |
tcatcactttcgtgcttctctctccctctcgttggtgtcggcgc |
10990903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 7267354 - 7267323
Alignment:
| Q |
1 |
tcatcactttcgtgcttctctctccctctcgc |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7267354 |
tcatcactttcgtgcttctctctccctctcgc |
7267323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 83 - 218
Target Start/End: Original strand, 49737322 - 49737457
Alignment:
| Q |
83 |
ctatacatgattattttccatggtagattccatcatacaagtaactgaaattaatagttgaatacaaatcaaattgttttagtcttgacatactcattcg |
182 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
49737322 |
ctatacatagttatttcccatggtagattccatcatacaagtaactgaaattaaaagttgaatacaaatcaaactgttttagtcttgacatacccattcg |
49737421 |
T |
 |
| Q |
183 |
gtgaatcaaaatttaattgttggtgcaacgttgagt |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
49737422 |
gtgaatcaaaatttaattgttggtgaaacattgagt |
49737457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University