View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11870_low_60 (Length: 230)

Name: NF11870_low_60
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11870_low_60
NF11870_low_60
[»] chr5 (1 HSPs)
chr5 (24-213)||(3338164-3338353)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 3338353 - 3338164
Alignment:
24 acaaagggcatctttggatgcatgggttttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattat 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3338353 acaaagggcatctttggatgcatgggttttagtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattat 3338254  T
124 tatcactaattaattttaggtaggtttcagagatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3338253 tatcactaattaattttaggtaggtttcagagatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg 3338164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University