View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_61 (Length: 228)
Name: NF11870_low_61
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 200
Target Start/End: Original strand, 12536912 - 12537100
Alignment:
| Q |
12 |
agatgaaagaaacttacacagattgtgttaattggtggttgtttctttgatcatattgtgtcactcattgaagcagttggtgttgctcgagaaacaccaa |
111 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12536912 |
agatggaagaaacttacacagatcgtgttaattggtggttgtttctttgatcatattgtgccattcattgaagcagttggtgttgctcgagatacaccaa |
12537011 |
T |
|
| Q |
112 |
gttgagtttgcctaatatgatccagacaagagtattcgcacgttacgactattattactgagcatgttattttgatatgtcgtattttt |
200 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12537012 |
gttgaatttgcctagtatgatccagacaagagtattcgcacgttacgactattattattgagcatgttattttgatatgtcgtattttt |
12537100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 12536230 - 12536307
Alignment:
| Q |
12 |
agatgaaagaaacttacacagattgtgttaattggtggttgtttctttgatcatattgtgtcactcattgaagcagttg |
90 |
Q |
| |
|
||||| ||||||||||| ||||| |||||| ||||||| ||||||||||| || || |||||| || |||||| ||||| |
|
|
| T |
12536230 |
agatggaagaaacttacgcagatcgtgtta-ttggtggctgtttctttgaacacatagtgtcattctttgaagtagttg |
12536307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 20193890 - 20193850
Alignment:
| Q |
159 |
actattattactgagcatgttattttgatatgtcgtatttt |
199 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
20193890 |
actattattaccgagcaatttattttgatatgtcgtatttt |
20193850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University