View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11870_low_66 (Length: 213)
Name: NF11870_low_66
Description: NF11870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11870_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 26112083 - 26112185
Alignment:
| Q |
1 |
tgattgaactactagcctctcaaatattcttgatgggaatatgagaatccatctataactatatatagataaaggaacatgtgattttggattgatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26112083 |
tgattgaactactagcctctcaaatattcttgatgggaatatgagaatacatctatacctatatatagataaaggaatatgtgattttggattgatattt |
26112182 |
T |
|
| Q |
101 |
tca |
103 |
Q |
| |
|
||| |
|
|
| T |
26112183 |
tca |
26112185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 26112815 - 26112901
Alignment:
| Q |
127 |
aattaccagtattatgtgtccgtctttccgcttttatattacatataattgaatatttattttattgtatacggttataaattttct |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26112815 |
aattaccagtattatgcgtccgtctttccgcttttatattacatataattgaatatttattttattgtatatggttataaattttct |
26112901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 26056513 - 26056616
Alignment:
| Q |
1 |
tgattgaactactagcctctcaaa--tattcttgatgggaatatgagaatccatctataactatatatagataaaggaacatgtgattttggattgatat |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |||||||||||| |||| | |
|
|
| T |
26056513 |
tgattgaactactagcctctcaaacatattcttgatgggaatatgagaattcatctatacctatatatagaaaaaggaatgtgtgattttggagtgattt |
26056612 |
T |
|
| Q |
99 |
tttc |
102 |
Q |
| |
|
|||| |
|
|
| T |
26056613 |
tttc |
26056616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 26085750 - 26085817
Alignment:
| Q |
1 |
tgattgaactactagcctctcaaatattcttgatgggaatatgagaatccatctataactatatatag |
68 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
26085750 |
tgattgaactactagcctctcaaacattcttgatgggaatatgagaattcatctatacctatatatag |
26085817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University