View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_high_32 (Length: 242)
Name: NF11871_high_32
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_high_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 49703738 - 49703499
Alignment:
| Q |
3 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703738 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
49703639 |
T |
 |
| Q |
103 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703638 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
49703539 |
T |
 |
| Q |
203 |
attaggcgtaccatcttctggtattggactaacaggtgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703538 |
attaggcgtaccatcttctggtattggactaacaggtgct |
49703499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University