View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_high_8 (Length: 535)
Name: NF11871_high_8
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 428; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 1 - 517
Target Start/End: Original strand, 39659058 - 39659589
Alignment:
| Q |
1 |
gccgaaagaggaatagttttgggtgacggagcctttatcgtcccatttaggatcttctgcaagggattgtaacagtttgggaggaatagtgaaagcgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39659058 |
gccgaaagaggaatagttttgggtgacggagcctttatcgtcccatttaggatcttctgcaagggattgtaacagtttgggaggaatagtgaaagcgggt |
39659157 |
T |
 |
| Q |
101 |
ttcagaactttaggattcttctttggaagacccacacgtacctttgggcgagattgtttgtactttcttcgtgatcctcccattct------------tc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
39659158 |
ttcagaactttaggattcttctttggaagacccacacgtacctttgggcgagattgtttgtactttcttcgtgatcttcccattcttcttcttcttcttc |
39659257 |
T |
 |
| Q |
189 |
ttcttctctctttgcgtctgcaacagcgtaagcaagatagggtttttcgagtatgtaattagggtttagggtttcaaatcaaatgaaatcatttcaatcc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39659258 |
ttcttctctctttgcgtctgcaacagcgtaagcaagatagggtttttcgagtatgtaattagggtttagggtttcaaatcaaatgaaatcatttcaatcc |
39659357 |
T |
 |
| Q |
289 |
taaacgctgtcgtttcctttcgttttggaatttagtgcttgaaatgggctcacctagcccattt---gtgaaaattgtaattttaatttgatatctgctg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39659358 |
taaacgctgtcgtttcctttcgttttggaatttagtgcttgaaatgggctcacatagcccatttatattgaaaattgtaattttaatttgatatctgctg |
39659457 |
T |
 |
| Q |
386 |
gttacacccctctattacattatttaacaataatgatactctaaaacataaatacctctagcctcatattcannnnnnnnnnnaaagaacctcatattca |
485 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39659458 |
gttacacccctctattacattatttaacaataatgatactctaaaatataaatacctctagcctcatattcatttttttttttaaagaacctcatattca |
39659557 |
T |
 |
| Q |
486 |
ttttaaaaaccccttatatttattgttatttt |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39659558 |
ttttaaaaaccccttatatttattgttatttt |
39659589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University