View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_20 (Length: 351)
Name: NF11871_low_20
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 7721322 - 7721155
Alignment:
| Q |
13 |
gtgttttatttttcccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtcttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721322 |
gtgttttatttttcccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtcttta |
7721223 |
T |
|
| Q |
113 |
ctgttctagttgtgcaagtatagagttgttttgtctttaccacttgttttgcgagtagcgggtgaagg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7721222 |
ctgttctagttgtgcaagtatagagttgttttgtctttgccacttgttttgcgagtagcgggtgaagg |
7721155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 316
Target Start/End: Complemental strand, 7721046 - 7721018
Alignment:
| Q |
288 |
acggttgatattaacaggtttaggtgtgg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7721046 |
acggttgatattaacaggtttaggtgtgg |
7721018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University