View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_23 (Length: 330)
Name: NF11871_low_23
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 7 - 319
Target Start/End: Complemental strand, 51499493 - 51499181
Alignment:
| Q |
7 |
ataatctctcaaggttgcatgtacttacaggctgccaagagcatctcatcacgcacgcggattgcaccagagatgatcaaacccaaaccaaatccgggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51499493 |
ataatctctcaaggttgcatgtacttacaggctgccaagagcatctcatcacgcacgcggattgcaccagagatgatcaaacccaaaccaaatccgggaa |
51499394 |
T |
|
| Q |
107 |
aaatgtaagcattgttggactaaattgcattgcagcaaaacaaaatattaaagtcagtcactaattttggtaatgtatgtctgttgaaaaagaaaatgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51499393 |
aaatgtaagcattgttggactaaattgcattgcagcaaaacaaaatattaaagtcagtcactaattttggtaatgtatgtctgttgaaaaagaaaatgct |
51499294 |
T |
|
| Q |
207 |
ttgttaagtattgaattaaaacctgtccaggaacaaaaacttttccttcatattcaacaggatcaaatgggcttccactagcaaaaattgctttaccctg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51499293 |
ttgttaagtattgaattaaaacctgtccaggaacaaaaacttttccttcatattcaacaggatcaaatgggcttccactagcaaaaattgctttaccctg |
51499194 |
T |
|
| Q |
307 |
caaataaaagaga |
319 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51499193 |
caaataaaagaga |
51499181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 127
Target Start/End: Original strand, 43205925 - 43206023
Alignment:
| Q |
29 |
acttacaggctgccaagagcatctcatcacgcacgcggattgcaccagagatgatcaaacccaaaccaaatccgggaaaaatgtaagcattgttggact |
127 |
Q |
| |
|
||||||||||||| | ||||| |||||| | || |||||||| || || || | | |||||||||||| || || |||||||||||||||||||||| |
|
|
| T |
43205925 |
acttacaggctgctagaagcatatcatcatgtactcggattgctcccgacatcactatacccaaaccaaagcctgggaaaatgtaagcattgttggact |
43206023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University