View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_25 (Length: 300)
Name: NF11871_low_25
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_25 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 48 - 300
Target Start/End: Complemental strand, 31786329 - 31786074
Alignment:
| Q |
48 |
catgaacaaaagtaaataagatctatatttccaagtatattaagcacacttagaaaaatatgagtataaa--atgaaaaattatcactagaa-gatcaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||| | |||||| ||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
31786329 |
catgaacaaaagtaaataagatctatcttttcaagtatattaaacccacttacaaaaatatgagtataaattatgaaaaattatcactagaatgatcaaa |
31786230 |
T |
 |
| Q |
145 |
attacaaaatttagtgttattctaatgatttaaaagtggcaatttgttgtgtattgaactctatggttgagggcaggcatttctctctttgtttctatca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31786229 |
attacaaaatttagtgttattctaatgatttaaaagtggcaatttgttgtgtattgaactctatgattgagggcaggcatttctctctttgtttctatca |
31786130 |
T |
 |
| Q |
245 |
atccaaacatatttctttcaattggcttttgggggctagtgcttggtttctgttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786129 |
atccaaacatatttctttcaattggcttttgggggctagtgcttggtttctgttct |
31786074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University