View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_30 (Length: 264)
Name: NF11871_low_30
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 22449237 - 22449494
Alignment:
| Q |
1 |
ccatttgtattagagatcctcaacatttatcaatattttgtatcccttttcttcgaaatacgtttctgttttggcaaaaaatgatcattgtggctttctg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22449237 |
ccattggtattagagatcctcaacatttatcaatattttgtatcccttttcttcgaaatacgtttctgttttggcaaaaaatgatcatcgtggctttctg |
22449336 |
T |
 |
| Q |
101 |
cttttatagaactcaaaaatcccattttttatgaaccgcaactgcgcatcgcacatacctttgcacatcgcgtattaggcagtagccgaaacattccggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22449337 |
cttttatagaactcaaaaatcccattttttatgaaccgcaactgcgcatcgcacatatctttgcacatcgcgtattaggcagtagccgaaacattccggg |
22449436 |
T |
 |
| Q |
201 |
tcttcaatcttgtgcgttgtgcagctttcatgcacattgtgcagcttttctctgcttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22449437 |
tcttcaatcttgtgcgttgtgcagctttcatgcacattgtgcagcttttctctgcttc |
22449494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University