View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_31 (Length: 261)
Name: NF11871_low_31
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 22449005 - 22448752
Alignment:
| Q |
1 |
taaatatttactaaagaacagcatctatccataggtaagttta--ccaagatataacatatgcaatcaagcgaacatgttaactactcgggcagtaaagg |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22449005 |
taaatatttactaaagaacagcacctatccataggtaagtttagtccaagatataacatatgcaatcaagcgaacatgttaactactcgggcagtaaagg |
22448906 |
T |
|
| Q |
99 |
caatctattgaagttgttcagtgagccattagaactgccattggaggaggtaaaatcatcaaattcactttcatcatcgaactcagaagtttcactagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22448905 |
caatctattgaagttgttcagtgagccattggaactgccattggaggaggtaaaatcatcaaattcactttcatcatcgaactcagaagtttcactagtt |
22448806 |
T |
|
| Q |
199 |
atcatttcatccgacccataatgggatggcaggatgcgcagatgatgtccatct |
252 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22448805 |
atcatttcatccgacccgtaatgggatggcaggatgcgcagatgatgtacatct |
22448752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University