View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_38 (Length: 241)
Name: NF11871_low_38
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31785981 - 31785759
Alignment:
| Q |
1 |
ttgagggatgaaactgccacacacaattaccctggtttgcttcttctctaagaaatggctctccaactctagaagcaattaaaatcaaag-aaaataatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||| |
|
|
| T |
31785981 |
ttgagggatgaaactgccacacacaattaccctggtttgcttcttctctaagaaatggctctccaactctagaagcaattaaaatcaatgaaaaaaaatt |
31785882 |
T |
 |
| Q |
100 |
agactatattgtacattaataatttttatttaacgaaaaatgttagtaataacatgattcatcttgggaataattgcacttgaatggaagacaagtgggt |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || | |||| |
|
|
| T |
31785881 |
agactatattgtacattaat-atttttatttaacaaaaaatgttagtaataacatgattcatcttggggataattgcacttgaatggaagtcaggcgggt |
31785783 |
T |
 |
| Q |
200 |
aatatcaattctcgtaaacataat |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31785782 |
aatatcaattctcgtaaacataat |
31785759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University