View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11871_low_50 (Length: 201)
Name: NF11871_low_50
Description: NF11871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11871_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 1350627 - 1350786
Alignment:
| Q |
22 |
ccgacctagcaatcaacacctctgcatttcataacgaccttcacccacttcaagcccccagccttttgccgtcgacgacatagacaccagtttgcgtcac |
121 |
Q |
| |
|
|||||||||||||||||||||||| | | | || ||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350627 |
ccgacctagcaatcaacacctctg---tccctcacaaccttcatccacgtcaagccc--agccttttgccgtcgacgacatagacaccagtttgcgtcac |
1350721 |
T |
|
| Q |
122 |
tcactcactttctatcatcgccatgttctcagaactgtctcaaaacactaggcatacaccctttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350722 |
tcactcactttctatcatcgccatgttctcagaactgtctcaaaacactaggcatacaccctttg |
1350786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University