View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11873_high_17 (Length: 222)
Name: NF11873_high_17
Description: NF11873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11873_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 24 - 134
Target Start/End: Complemental strand, 9072706 - 9072596
Alignment:
| Q |
24 |
gacttttcacaatgatactgacagggaagattcaaccatgaaatttcaaatccataaactaacgacttgtgtatttcatcatatgatattacttgatttc |
123 |
Q |
| |
|
||||||||||||| || |||||| |||||| |||||||||||| ||||||||||| ||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9072706 |
gacttttcacaataattctgacaaggaagacgcaaccatgaaatctcaaatccatacactaatgccttttgtatttcatcatatgatattacttgatttc |
9072607 |
T |
|
| Q |
124 |
cttgcaaaccc |
134 |
Q |
| |
|
||||||||||| |
|
|
| T |
9072606 |
cttgcaaaccc |
9072596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 41 - 131
Target Start/End: Complemental strand, 9100228 - 9100138
Alignment:
| Q |
41 |
ctgacagggaagattcaaccatgaaatttcaaatccataaactaacgacttgtgtatttcatcatatgatattacttgatttccttgcaaa |
131 |
Q |
| |
|
|||||| ||||| |||| ||||||||| ||||||||||| ||||||| ||| || || ||||||||| | ||||||||||| ||||||| |
|
|
| T |
9100228 |
ctgacatggaagtttcatccatgaaatctcaaatccatatactaacgccttatgaatgatatcatatgaaagtacttgatttctttgcaaa |
9100138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 9072602 - 9072559
Alignment:
| Q |
164 |
caaacccttccaagaagtgggactaacaaatttcacatgacaac |
207 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9072602 |
caaacccttcaaagaagtgggagtaataaatttcacatgacaac |
9072559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 133
Target Start/End: Complemental strand, 8864538 - 8864436
Alignment:
| Q |
31 |
cacaatgatactgacagggaagattcaaccatgaaatttcaaatccataaactaacgacttgtgtatttcatcatatgatattacttgatttccttgcaa |
130 |
Q |
| |
|
||||| ||| || ||| |||||||| ||||||||||| ||||||||||| || || | ||||| || ||||||| || | ||||||||||| |||||| |
|
|
| T |
8864538 |
cacaaagattcttacaaggaagattgaaccatgaaatatcaaatccatataccaatgctttgtgcatgacatcataggaaagtacttgatttctttgcaa |
8864439 |
T |
|
| Q |
131 |
acc |
133 |
Q |
| |
|
||| |
|
|
| T |
8864438 |
acc |
8864436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University