View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11873_low_17 (Length: 250)
Name: NF11873_low_17
Description: NF11873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11873_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 113 - 230
Target Start/End: Complemental strand, 5103435 - 5103318
Alignment:
| Q |
113 |
tccatattcctcggaggctttgatgatgtttcttatgatgtcatcacgatcatgtcctcaaagatcaatcactggaattttctggttagtggacaaaaca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5103435 |
tccatattcctcggaggctttgatgatgtttcttatgatgtcatcacgatcatgtcctccaagatcaatcactggaactttctggttagtggacaaaaca |
5103336 |
T |
 |
| Q |
213 |
tatacagcattgcaaggt |
230 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
5103335 |
tgtacagcattgcaaggt |
5103318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 113 - 212
Target Start/End: Complemental strand, 5110145 - 5110046
Alignment:
| Q |
113 |
tccatattcctcggaggctttgatgatgtttcttatgatgtcatcacgatcatgtcctcaaagatcaatcactggaattttctggttagtggacaaaaca |
212 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5110145 |
tccatattcctcggaggacttaacgatgtttcttatgatatcatcacgatcatgtcctccaagatcaatcactggaattgtcttaatagtggacaaaaca |
5110046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 5103541 - 5103482
Alignment:
| Q |
1 |
tctctctattattccgtcttcatttcaacnnnnnnnctacttgcatgcgtagttgagaagt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5103541 |
tctctctattattccgtcttcatttcaac-ttttttctacttgcatgcgtagttgagaagt |
5103482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University