View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11874_high_31 (Length: 261)
Name: NF11874_high_31
Description: NF11874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11874_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 3 - 248
Target Start/End: Complemental strand, 55229520 - 55229275
Alignment:
| Q |
3 |
ggagaagcagagaaagatttagcagctgtaaatataaactactattaattttgtttagaaacagactcgtttacatataagtaaagtaggtacatagcca |
102 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55229520 |
ggagaagcagaaaaagatttagcagctgtaaatataaactactgttaattttgtttagaaacagactcgtttacatataagtaaagtaggtacatagcca |
55229421 |
T |
|
| Q |
103 |
ttttgtttgaccatttcagtagaatggattgtatcattacattcatactatgatgcaaattcaatcaaaaatgttacttaaagctggtcaatggatcaaa |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55229420 |
ttttgtttgaccatttcattagaatggattgtgtcattacattcatactatgatgcaaattcaatcaaaaatgttacttaaagctggtgaatggatcaaa |
55229321 |
T |
|
| Q |
203 |
ttgcaggtgccactcctcattccaagattgatcataggaagaaggt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55229320 |
ttgcaggtgccactcctcattccaagattgatcataggaagaaggt |
55229275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University