View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11874_high_40 (Length: 218)
Name: NF11874_high_40
Description: NF11874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11874_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 3809712 - 3809530
Alignment:
| Q |
17 |
agagatcgaaaggtagatcgttttgacaatggaacttgacgcattaactccaaatctaactgaacacgtttccttccacagcgtgttttcttatgataag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
3809712 |
agagatcgaaaggtagatcgttttgacaatggaacttgacgcattaactccaaatctaactgaacacatttccttccacatcgttttttcttatgataag |
3809613 |
T |
 |
| Q |
117 |
cattaccagtctccattacttgtttccatatacgaaaaatgatacttctatgaacatcgtatagtaaagctactcgtgatatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
3809612 |
cattaccagtctccattacttgtttccatatacgataaatgatacttctatgaacatcgtatagtaaagctgctcgggatatt |
3809530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University