View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11874_low_30 (Length: 269)
Name: NF11874_low_30
Description: NF11874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11874_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 4383922 - 4383679
Alignment:
| Q |
10 |
gagcacagactgaatacaggaatttaaatttcacttcaattgaagtaactttagtacatgttctagtatgtaatcaattaattatgtcattcacatgtaa |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4383922 |
gagcacaaactgaatacaggaatttaaatttcacttcaattgaagtaactttagtacatgttctagtatgtaatcaattaattatgtcattcacatgtaa |
4383823 |
T |
|
| Q |
110 |
ttcaatgactataacaactgaactgaatactgttattattttctttggtttgttcaataagtaaccttacggatcatagccatgtcctctaactttcatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4383822 |
ttcaatgactataacaactgaactgaatactgttattattttctttggattgttcaataagtaaccttacggatcatagccatgtcctctaactttcatg |
4383723 |
T |
|
| Q |
210 |
gctgtaatagacgattgcatatgccgagacctggcaataataaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4383722 |
gctgtaatagacgattgcatatgccgagacctggcaataataaa |
4383679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University