View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11874_low_39 (Length: 224)
Name: NF11874_low_39
Description: NF11874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11874_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 42454263 - 42454413
Alignment:
| Q |
1 |
ttgaactttgaatggtggttgtgacctgtgaagccataacaa-----agt------tgtaatattgatttgagctactatattcttattgctcattgtta |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42454263 |
ttgaactttgaatggtggttgtgacctgtgaagccataacaagtagtagtgattcatgtaatattgatttgagctactatattcttattgctcatagtta |
42454362 |
T |
 |
| Q |
90 |
gcaaa---tatttggattttaattgaccgtttcagaaacttctcaatcaaa |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42454363 |
gcaaatactatttggattttaattgaccgtttcagaaacttctcaatcaaa |
42454413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 186
Target Start/End: Original strand, 42454434 - 42454488
Alignment:
| Q |
136 |
aaggtatccttagtggtggt----gggaaagccgcggattgtgcctggtgttcgg |
186 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
42454434 |
aaggtatccttagtggtggttggtgggaaagctgcggattgtgcgtggtgttcgg |
42454488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University