View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11875_high_2 (Length: 428)
Name: NF11875_high_2
Description: NF11875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11875_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 47563742 - 47563618
Alignment:
| Q |
7 |
gatatatgtctccgttgctaaggaaaaacacattcttttactctgttatgccttttccgtcacgtttgaatctttgaggaaagtataacttatacttcaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47563742 |
gatatatgtctccgttgctaaggaaaaacacattcttttactctgttatgccttttccgtcacgtttgaatctttgaggaaagtataacttatacttcaa |
47563643 |
T |
|
| Q |
107 |
tcgtttgctgtattaacattgctat |
131 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
47563642 |
tcgtttgctgtaataacattgctat |
47563618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 241 - 328
Target Start/End: Complemental strand, 47563617 - 47563530
Alignment:
| Q |
241 |
atggatgattattgtatttggaaaaaggaattttgtcgtgagaatttctatcgtgcatctgtcaaatcaatatgtttaggtataagag |
328 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47563617 |
atggatgattattgtatatggaaaaaggaattttgtcgtgagaatttctatcgtgcatctgtcaaatcaatatgtttaggtataagag |
47563530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 47 - 149
Target Start/End: Original strand, 2535112 - 2535211
Alignment:
| Q |
47 |
ctctgttatgccttttccgtcacgtttgaatctttgaggaaagtataacttatacttcaatcgtttgctgtattaacattgctatttagaaaactcaatt |
146 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||| |||||||||||||||||||| ||| |||| |||||||||||||||||||||| |||| |
|
|
| T |
2535112 |
ctctgttatgcctttcccgtcgtgtttgaatatttgaggaa-gtataacttatacttcaatccttttctgt--taacattgctatttagaaaacttaatt |
2535208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University