View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11875_high_4 (Length: 260)
Name: NF11875_high_4
Description: NF11875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11875_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 238
Target Start/End: Complemental strand, 31171114 - 31170887
Alignment:
| Q |
11 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171114 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
31171015 |
T |
 |
| Q |
111 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtannnnnnncctttctgctcaatggctactaatttatgacaaacaattttgagcaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171014 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtattttttccctttctgctcgatggctactaatttatgacaaacaattttgagcaaa |
31170915 |
T |
 |
| Q |
211 |
tatcacttgctttttaacttttcatact |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31170914 |
tatcacttgctttttaacttttcatact |
31170887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 35224494 - 35224424
Alignment:
| Q |
11 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggcc |
81 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35224494 |
tggacatctgctgcacagctatcattactcgaagatgaaatgcgccgtatagaaagagtcaatgtaaggcc |
35224424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University