View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11876_low_4 (Length: 370)
Name: NF11876_low_4
Description: NF11876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11876_low_4 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 338; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 17 - 370
Target Start/End: Original strand, 38171209 - 38171562
Alignment:
| Q |
17 |
catacagtgcttccatcaagttcctaccagagatattgtttgtacacagcaacctttatctggctggtcgccaacctctaccacctcgatggaatggtct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38171209 |
catacagtgcttccatcaagttcctaccagagatattgtttgtacagagcaacctttatctggctggtcgccaacctctaccacctcgatggaatggtct |
38171308 |
T |
 |
| Q |
117 |
tcttccacggctagcagaaaatgctctcccagggccatcataagcaccaggattaaattgatgatggaattgcagaggatgctgattatctgaaattgaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38171309 |
tcttccacggctagcagaaaatgctctcccagggccatcataagcaccaggattaaattgatgatggaattgcggaggatgctgattatctgaaattgaa |
38171408 |
T |
 |
| Q |
217 |
acagcatgaaaatttgatgggaggttgaattggtgaggaggaccaccttgattgccagatatatggtttgaatgaaaattggctggtgggttgaattgga |
316 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38171409 |
acagcatgaaaatttgatggggggttgaattggtgaggaggaccaccttgattgccagatatatggtttgaatgaaaattggctggtgggttgaattgga |
38171508 |
T |
 |
| Q |
317 |
gaggaggaccaccttgattgcctgcaatatgatttggattaatattggcaggtt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38171509 |
aaggaggaccaccttgattgcctgcaatatgatttggattaatattggcaggtt |
38171562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 222 - 370
Target Start/End: Original strand, 38171480 - 38171628
Alignment:
| Q |
222 |
atgaaaatttgatgggaggttgaattggtgaggaggaccaccttgattgccagatatatggtttgaatgaaaattggctggtgggttgaattggagagga |
321 |
Q |
| |
|
||||||||| | ||| ||||||||||| ||||||||||||||||||||| | ||||| |||| || || |||||| ||| ||||||||||||||| | |
|
|
| T |
38171480 |
atgaaaattggctggtgggttgaattggaaaggaggaccaccttgattgcctgcaatatgatttggattaatattggcaggttggttgaattggagagaa |
38171579 |
T |
 |
| Q |
322 |
ggaccaccttgattgcctgcaatatgatttggattaatattggcaggtt |
370 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38171580 |
ggaccaccttgattgcctgcaatacgatttggattaatattggcaggtt |
38171628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 239 - 358
Target Start/End: Original strand, 38171563 - 38171682
Alignment:
| Q |
239 |
ggttgaattggtgaggaggaccaccttgattgccagatatatggtttgaatgaaaattggctggtgggttgaattggagaggaggaccaccttgattgcc |
338 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| | ||| | |||| || || |||||| ||| ||||||||||||| |||| ||||||||| ||| |
|
|
| T |
38171563 |
ggttgaattggagagaaggaccaccttgattgcctgcaatacgatttggattaatattggcaggttggttgaattggagccaaggaacaccttgatggcc |
38171662 |
T |
 |
| Q |
339 |
tgcaatatgatttggattaa |
358 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
38171663 |
tgaaatatgatttggattaa |
38171682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University