View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_high_22 (Length: 240)
Name: NF11877_high_22
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 78 - 222
Target Start/End: Complemental strand, 31809154 - 31809010
Alignment:
| Q |
78 |
gctttttgaaggtaactttaaggaggacagaaatgttaccaacttaagaaacaaaaattacttgtggtttgatttgtatgaaaactgaaatgaaatcaat |
177 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31809154 |
gctttttgaaggtaacgttaaggaggacagaaatgttaccaacttaagaaacaaaaattacttgtggtttggtttgtatgaaaactgaaatgaaatcaat |
31809055 |
T |
 |
| Q |
178 |
gtagtataattcagttgactatactttcttatttattggtgccac |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31809054 |
gtagtataattcagttgactatactctcttatttattggtgccac |
31809010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 55
Target Start/End: Complemental strand, 31809201 - 31809167
Alignment:
| Q |
21 |
cctttgtgtgaggccagtataggataagaggctgc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809201 |
cctttgtgtgaggccagtataggataagaggctgc |
31809167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University