View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_high_24 (Length: 235)
Name: NF11877_high_24
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 29457603 - 29457386
Alignment:
| Q |
1 |
atctataaggaggaaaaggttgttattacttttttaagaaactttataaattatatannnnnnnattactacagaaactgaaagtataaataagaaccct |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29457603 |
atctataaggaggaaaagggtgttattacttttttaagaaactttataaattatatatttttttattactacagaaactgaaagtataaataagaaccct |
29457504 |
T |
 |
| Q |
101 |
agagaagaaacactgaccctattgttcttctttgtttatctctcttct--gtgtttatgttgagatggattggatagaaaatagttagattatagattag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29457503 |
agagaagaaacactgaccctattgttcttctttgtttatctctcttctgtgtgtttatgttgagatggattggatagaaaatagttagattatagattag |
29457404 |
T |
 |
| Q |
199 |
atatgggagggttggtgt |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29457403 |
atatgggagggttggtgt |
29457386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University