View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_high_9 (Length: 438)
Name: NF11877_high_9
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 168 - 432
Target Start/End: Original strand, 22265885 - 22266152
Alignment:
| Q |
168 |
ttccatatttatttatgctaaaattggaactgtttagtagttattattgatccaaagggtcagttgtgaataggagtctttctctttgctggagaatagt |
267 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22265885 |
ttccatatttatttatgctaaaattagaactgtttagtagttattattgatccaaagggtcagttgtgaataggagtctttctctttgctggagaatagt |
22265984 |
T |
|
| Q |
268 |
ccatgtcagatatctctataagttcctcacgaacatcctcttcttgttgctgttttactcttatttcgtgttcttttccattagctttgtcatttcc--- |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22265985 |
ccatgtcagatatctctataagttcctcacgaacatcctcttcttgttgctgttttactcttatttcgtgttcttttccattagctttgtcatttccagt |
22266084 |
T |
|
| Q |
365 |
agtatttccttcattccctccagcattcactttctttacatttgtgttcaaaaccacgtctctgcttc |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||| |
|
|
| T |
22266085 |
agtatttccttcattccctccagcattcactttctttacatttgtgttgaaagccacgtccctgcttc |
22266152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 22265762 - 22265715
Alignment:
| Q |
20 |
ttcttatct-caaccattggatggtttgacaaagttataatagtacca |
66 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22265762 |
ttcttatcttcaaccattggatggtttgacaaagttataatagtacca |
22265715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University