View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_low_24 (Length: 245)
Name: NF11877_low_24
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 6737483 - 6737265
Alignment:
| Q |
11 |
caaaggtcatgtcgatatcaagaaaatcatgattcacaactactaaaattcttcttggtctaaagtctaaaccacttaaaatgaagaaaatcgcaagctg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6737483 |
caaatgtcatgtcgatatcaagaaaatcatgattcacaactactaaaattcttcttggtctaaagtctaaaccacttaaaatgaagaaaatcgcaagctg |
6737384 |
T |
 |
| Q |
111 |
caaaattatctcaatcaatcacaatattataaaccaaaattctacaaaaacaagcaattgcaacaagatataataattttatttatggtttatagtgggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6737383 |
caaaattatctcaatcaatcacaatattataaaccaaaattctacaaaaacaagcaattgcaacaagatataataattttatttatggtttatagtgggt |
6737284 |
T |
 |
| Q |
211 |
atctctcaacccatatttg |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6737283 |
atctctcaacccatatttg |
6737265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University