View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_low_27 (Length: 238)
Name: NF11877_low_27
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_low_27 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 82 - 238
Target Start/End: Original strand, 31286335 - 31286489
Alignment:
| Q |
82 |
aatggatcaacgtcgcataatggagtcgctaagtcagtgaaatagaagctaaaatcatttaacgttgtttttcatgatttatgcgcagggtcccatattc |
181 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||||| |||||||||||||||| |||||||||||| ||||||||| || ||||||||| ||| |
|
|
| T |
31286335 |
aatggatcaatttcacataatggagtcactaagtcagtgaaagagaagctaaaatcattcaacgttgtttttgatgatttat--gctgggtcccatcttc |
31286432 |
T |
|
| Q |
182 |
gcagtttgtctttgacgagcagttgaggtgaagaaataagaatttcggttgagaaac |
238 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31286433 |
gtagtttgtctttgatcagcagttgaggtgaagaaataagaatttcggttgagaaac |
31286489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University