View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11877_low_29 (Length: 224)
Name: NF11877_low_29
Description: NF11877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11877_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 56469338 - 56469531
Alignment:
| Q |
15 |
cagagaatgtaaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgtacggttctgcatgcacttccaaataaggcaaccccttcatttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469338 |
cagagaatgtaaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgtacggttctgcatgcacttccaaataaggcaaccccttcatttc |
56469437 |
T |
 |
| Q |
115 |
cactatttgatcataaacacctttgttaaaacaatctgccacagactttgagatgaggagaactaacatgaccaatggtagcatgaggaggttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56469438 |
cactatttgatcataaacacctttgttaaaacaatctgccacagactttgagatgaggagaactaacatgaccaatggtagcatgaggaggttg |
56469531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 25 - 198
Target Start/End: Complemental strand, 155206 - 155033
Alignment:
| Q |
25 |
aaacagtggaccagaaacaacatcaccggcaactaaatgcctcatgtacggttctgcatgcacttccaaataaggcaaccccttcatttccactatttga |
124 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| ||||||||| || |||||||| |||||| |||||| | ||||||| |||| || ||| |
|
|
| T |
155206 |
aaacagtggaccagaaacaacatcccctgcaactaaattcctcatgtatggctctgcatgtgcttccatataaggtagtcccttcaacgccacaatctga |
155107 |
T |
 |
| Q |
125 |
tcataaacacctttgttaaaacaatctgccacagactttgagatgaggagaactaacatgaccaatggtagcat |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
155106 |
tcataaacacctttgttaaaacaatcagccactgtcttagaaatgaggagaaccaacatgaccaatggtagcat |
155033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University