View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_16 (Length: 322)
Name: NF11878_low_16
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_16 |
 | |
|
| [»] scaffold0119 (2 HSPs) |
| | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
| [»] scaffold0005 (4 HSPs) |
| | |
|
| [»] scaffold0684 (2 HSPs) |
| | |
|
| [»] scaffold0176 (2 HSPs) |
| | |
|
| [»] scaffold0085 (3 HSPs) |
| | |
|
| [»] scaffold0024 (3 HSPs) |
| | |
|
| [»] scaffold0007 (3 HSPs) |
| | |
|
| [»] scaffold0026 (3 HSPs) |
| | |
|
| [»] scaffold0001 (2 HSPs) |
| | |
|
| [»] scaffold0160 (2 HSPs) |
| | |
|
| [»] scaffold0056 (5 HSPs) |
| | |
|
| [»] scaffold0078 (2 HSPs) |
| | |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold1001 (1 HSPs) |
| | |
|
| [»] scaffold0065 (3 HSPs) |
| | |
|
| [»] scaffold0003 (3 HSPs) |
| | |
|
| [»] scaffold0472 (1 HSPs) |
| | |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold0712 (1 HSPs) |
| | |
|
| [»] scaffold0709 (1 HSPs) |
| | |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0123 (1 HSPs) |
| | |
|
| [»] scaffold0105 (1 HSPs) |
| | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
| [»] scaffold0291 (1 HSPs) |
| | |
|
| [»] scaffold0032 (1 HSPs) |
| | |
|
| [»] scaffold0326 (2 HSPs) |
| | |
|
| [»] scaffold0166 (2 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0428 (1 HSPs) |
| | |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 4e-35; HSPs: 192)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 28213503 - 28213598
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28213503 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaatagtctctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
28213598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 20661078 - 20661173
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20661078 |
atgatttgcacacgtgacacatgatgattgaactcatttattagaaaaatagtccctgtaaaatcttttgatttttaaaaaggtccctgcaaaata |
20661173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 5103880 - 5103786
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| |||| ||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5103880 |
atgatttgcacatgtgacacatgatgactgaacccatttattagaaatatagt-cctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
5103786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 26071420 - 26071515
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26071420 |
atgatttgcacacgtagcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccttgcaaaata |
26071515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 36973483 - 36973578
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
36973483 |
atgatttgcacacgtgacacatgatgactgaatccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtcactgcaaaata |
36973578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 35609305 - 35609497
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnn-gttgtttttggtccctgcaaatgtctcattttg |
128 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||| ||||||||||||||| ||||||||||||||||| | | || ||| |
|
|
| T |
35609305 |
ctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaattttttttttgttgtttttggtccctg----tcgc-cactttt |
35609399 |
T |
|
| Q |
129 |
gttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|| |||||||||||| |||||||||||||| |||| ||||||||| |||| |||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35609400 |
gtgatgatttgcacacgtgacacatgatgactgaacccatttattataaaa-tagtccctgcaaaatcttttaatttttaaaaaggtccctgcaaaata |
35609497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 1286917 - 1286822
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| ||||||||| |||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1286917 |
atgatttgcaagcgtgacacataatgactgaacccatttattggaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
1286822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 12145113 - 12145018
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| | ||||||||||| |||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12145113 |
atgatttgcacatataacacatgatgagtgaacccatttattagaaaaatagtccatgcaaaatcttttgatttttaaaaaggtctctgcaaaata |
12145018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 132 - 217
Target Start/End: Original strand, 10830659 - 10830744
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10830659 |
atgatttgcacacgtgacacaagatgactgaacccatttattagaaaaataatccctgcaaaatcttttgatttttaaaaaggtcc |
10830744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 32888810 - 32888905
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32888810 |
atgatttacacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttgaaaaggtctctgcaaaata |
32888905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 121 - 227
Target Start/End: Complemental strand, 45384 - 45278
Alignment:
| Q |
121 |
tcattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatg |
220 |
Q |
| |
|
||||||| || |||||||||||| ||| ||||||||| | || ||||||||| | ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45384 |
tcatttttgtgatgatttgcacacgtggtacatgatgactaaacccatttattaaagaaatagtccctgcaaaatcttttgattttgaaaaaggtccatg |
45285 |
T |
|
| Q |
221 |
caaaata |
227 |
Q |
| |
|
||||||| |
|
|
| T |
45284 |
caaaata |
45278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 225
Target Start/End: Complemental strand, 38554956 - 38554864
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
38554956 |
atgatttgcacac-tgacacatgatgactgaatccatttatgagaaaaatagtccctgtaaaatcttttgatttttaaaatggtccctgcaaaa |
38554864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 1381478 - 1381387
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
1381478 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
1381387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 18258296 - 18258387
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
18258296 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
18258387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 5904243 - 5904148
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| | |||||| ||||| | |||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
5904243 |
atgatttgcatacgtgacatatgataactgaacccatttattagaaaaatagtccatgcaaaatcttttgatttttaaaaaggtccctacaaaata |
5904148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 17070665 - 17070760
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||| | |||||||||||| |||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
17070665 |
atgatttgcacacgtggcacatgatgaatgaatccattttgtagaaaaatagtccttgcaaaatattttgatttttaaaaaggtctctgcaaaata |
17070760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 28107929 - 28108024
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
28107929 |
atgatttgcacacgtggcacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgattttgaaaaagctccttgcaaaata |
28108024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 31602277 - 31602372
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||| |||||| | ||||||||||||||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
31602277 |
atgatttgcacacgtggcacatgataattgaacccattttgtagaaaaatagtccctgcaaaatattatgatttttaaaaaggtccctgcaaaata |
31602372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 42596583 - 42596678
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||||||||||| | |||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
42596583 |
atgatttggacacatgacacatgataactgaacccatttattagaaaaatagtccctacaaaatcgtttgatttttaaaaaggtctatgcaaaata |
42596678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 1105018 - 1104944
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
1105018 |
atgatttgcacacgtggcacatgatgattgaacccatttattagagaaatagtccctgcaaaatcttttgatttt |
1104944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 35876690 - 35876793
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35876690 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35876789 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35876790 |
ggtt |
35876793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 132 - 217
Target Start/End: Original strand, 42553774 - 42553859
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||||||||| | |||| |||||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42553774 |
atgatttgcacacgtgacacatgataactgaactcatttattagaaaagtagtccctccaaaatcttttgatttttaaaaaggtcc |
42553859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 6912631 - 6912722
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
6912631 |
atttgcacatgtgtcacatgatgacttaaac-atttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
6912722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 19565698 - 19565607
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
19565698 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
19565607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 19685149 - 19685240
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
19685149 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
19685240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 20985858 - 20985949
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20985858 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
20985949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 24443513 - 24443604
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
24443513 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
24443604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 35928197 - 35928288
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35928197 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35928288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 40764548 - 40764639
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
40764548 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccttgcaaaata |
40764639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 1104860 - 1104946
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1104860 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
1104946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 9588465 - 9588387
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||| ||||||||| || ||||||||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
9588465 |
cacatgatgactgaacccatttattagagaaatagtccatgcaaaatcttttgattttgaaaaaggtccgtgcaaaata |
9588387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 28871783 - 28871861
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||| ||||||||| || ||||| ||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
28871783 |
cacatgatgactgaacccatttattagagaaataatccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
28871861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 1381609 - 1381506
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
1381609 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcatttt |
1381510 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
1381509 |
ggtt |
1381506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 19565829 - 19565726
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
19565829 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
19565730 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
19565729 |
ggtt |
19565726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 136
Target Start/End: Original strand, 20985728 - 20985835
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcattttg |
20985827 |
T |
|
| Q |
129 |
gttatgat |
136 |
Q |
| |
|
||| |||| |
|
|
| T |
20985828 |
gttttgat |
20985835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 35928066 - 35928169
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35928066 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35928165 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35928166 |
ggtt |
35928169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 37271704 - 37271601
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
37271704 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
37271605 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
37271604 |
ggtt |
37271601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 40764417 - 40764520
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
40764417 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaagtttttttgttgtttttggtccctgcaaatatgtctcatttt |
40764516 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
40764517 |
ggtt |
40764520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 212
Target Start/End: Original strand, 2636799 - 2636879
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaa |
212 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2636799 |
atgatttgcacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaa |
2636879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 35876821 - 35876912
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||| ||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35876821 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaacagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35876912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 37271573 - 37271482
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
37271573 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatctttttattttgtaaaaggtccctgcaaaata |
37271482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 135 - 222
Target Start/End: Complemental strand, 5917326 - 5917240
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5917326 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgca |
5917240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 5917458 - 5917354
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa---atgtctcattt |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
5917458 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatgtctcattt |
5917359 |
T |
|
| Q |
127 |
tggtt |
131 |
Q |
| |
|
||||| |
|
|
| T |
5917358 |
tggtt |
5917354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 19685378 - 19685292
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19685378 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19685292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 20661309 - 20661223
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20661309 |
ctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
20661223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 20986087 - 20986001
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
20986087 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
20986001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 24443742 - 24443656
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24443742 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
24443656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 29855737 - 29855832
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| | | ||||||| || |||| |||||||| |||||||||||||| ||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
29855737 |
atgatttgcacacgcggcacatgacgactgaacccatttatgagaaaaatagtccctaaaaaatcttttgatttttaaaaagatccctgcaaaata |
29855832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 40038625 - 40038719
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| | ||||||| || ||||||||| ||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
40038625 |
atgatttgcacacgtggcacatgatgactgaacctatttattagagaaatagtccatgcaaaatcttttga-ttttgaaaaggtccctgcaaaata |
40038719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 32108937 - 32109011
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
32108937 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccttgcaaaatcttttgatttt |
32109011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 1105146 - 1105043
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
1105146 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
1105047 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
1105046 |
ggtt |
1105043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 4736540 - 4736437
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||| ||||||||||||| |||||| ||| |||||||| |
|
|
| T |
4736540 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtctctgcaaatatgcctcatttt |
4736441 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
4736440 |
ggtt |
4736437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 24443382 - 24443485
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
24443382 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatttt |
24443481 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
24443482 |
ggtt |
24443485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21050911 - 21050855
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21050911 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaa |
21050855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 38170516 - 38170572
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38170516 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38170572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 38786161 - 38786217
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38786161 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
38786217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 1381249 - 1381335
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1381249 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
1381335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 35928456 - 35928370
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35928456 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35928370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 36973708 - 36973622
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36973708 |
ctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
36973622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 37271361 - 37271447
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37271361 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
37271447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 4736412 - 4736338
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||| |||||| ||| |||||||||| |||| ||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
4736412 |
atgatctgcacacgtggcacatgatgactgaacccatttattagagaaatagtcccggcaaaatcttttgatttt |
4736338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 6912499 - 6912603
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg-taannnnnnnnngttgtttttggtccctgcaa--atgtctcattt |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
6912499 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattt |
6912598 |
T |
|
| Q |
127 |
tggtt |
131 |
Q |
| |
|
||||| |
|
|
| T |
6912599 |
tggtt |
6912603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 6912857 - 6912799
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6912857 |
gactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6912799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 10408930 - 10408983
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10408930 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 28871640 - 28871743
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt-aannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||||| ||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
28871739 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
28871740 |
ggtt |
28871743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 45140 - 45196
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45140 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
45196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 293830 - 293886
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
293830 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgtaa |
293886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 2217496 - 2217552
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2217496 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2217552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4203768 - 4203712
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4203768 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
4203712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5904010 - 5904066
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5904010 |
ctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaa |
5904066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5950178 - 5950234
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5950178 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
5950234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 7075574 - 7075630
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7075574 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7075630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 18046040 - 18046096
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18046040 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
18046096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20660950 - 20661006
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
20660950 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaa |
20661006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20683749 - 20683805
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20683749 |
ctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaa |
20683805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21050577 - 21050633
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21050577 |
ctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaa |
21050633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 28863512 - 28863568
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28863512 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28863836 - 28863780
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28863836 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29692746 - 29692802
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29692746 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29692802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30800496 - 30800552
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30800496 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30800848 - 30800792
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30800848 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 36578081 - 36578025
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36578081 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
36578025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 40029495 - 40029439
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40029495 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40029439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 5917128 - 5917214
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5917128 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
5917214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 19565469 - 19565555
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19565469 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa |
19565555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 28108159 - 28108104
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
28108104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 30888162 - 30888217
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
30888162 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 32888686 - 32888776
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| | ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32888686 |
tgacgaaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaatttttttttgttgtttttggtccctgcaaat |
32888776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 35877050 - 35876964
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35877050 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35876964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 40764778 - 40764692
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40764778 |
ctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
40764692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 2636991 - 2636941
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
2636991 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 28550829 - 28550883
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28550829 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 39379608 - 39379558
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||| |
|
|
| T |
39379608 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 10409324 - 10409275
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
10409324 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18633601 - 18633654
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
18633601 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 19685019 - 19685072
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
19685019 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 25561707 - 25561760
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25561707 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 86
Target Start/End: Original strand, 28213366 - 28213431
Alignment:
| Q |
21 |
ttaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
28213366 |
ttaagaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
28213431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 29151518 - 29151571
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29151518 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 29151849 - 29151796
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
29151849 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 29172525 - 29172578
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29172525 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 29172884 - 29172831
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29172884 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 29875723 - 29875670
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29875723 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 35167163 - 35167110
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
35167163 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 38496780 - 38496727
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
38496780 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 1286684 - 1286740
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1286684 |
ctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
1286740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 2217852 - 2217800
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2217852 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5614168 - 5614224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
5614168 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
5614224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 5614528 - 5614472
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
5614528 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
5614472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 9179595 - 9179651
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
9179595 |
ctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaa |
9179651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10743726 - 10743782
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
10743726 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
10743782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11799456 - 11799400
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11799456 |
ctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaa |
11799400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 75
Target Start/End: Complemental strand, 12145184 - 12145136
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
12145184 |
tgactaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 16038379 - 16038435
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
16038379 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
16038435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 17070537 - 17070592
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17070537 |
ctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgtaa |
17070592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18046346 - 18046290
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
18046346 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18046290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18258525 - 18258469
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
18258525 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
18258469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20690735 - 20690791
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
20690735 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
20690791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 20690861 - 20690957
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaa-tcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| | || |||||||||| |||| |||||||| |||| ||||||| || |||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
20690861 |
atgatttgcatacatggcacatgatgaatgaactcatttattagaaatatagtccatgaaaaaatcttttgatttttaaaaagatccctgcaaaata |
20690957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25779160 - 25779104
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
25779160 |
ctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaa |
25779104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26133185 - 26133241
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26133185 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
26133241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26133411 - 26133355
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26133411 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26133355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27916463 - 27916519
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| | || ||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27916463 |
ctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgtaa |
27916519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28871992 - 28871936
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
28871992 |
ctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
28871936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29693088 - 29693032
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
29693088 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
29693032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 32108810 - 32108866
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
32108810 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaa |
32108866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 33336024 - 33335968
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33336024 |
ctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
33335968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 36577724 - 36577780
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36577724 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36577780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 38452394 - 38452338
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||| || |||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgtaa |
38452338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40038496 - 40038552
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
40038496 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaa |
40038552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40167788 - 40167844
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| ||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40167788 |
ctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40167844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 86
Target Start/End: Complemental strand, 16038741 - 16038682
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
16038741 |
tgactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaa |
16038682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 31156084 - 31156127
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31156084 |
gtccctgcaaaatattttgttttttaaaaaggtccatgcaaaat |
31156127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 40038856 - 40038770
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| | |||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40038856 |
ctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
40038770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 42596814 - 42596759
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
42596759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 31037395 - 31037453
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || ||||||||||| | | ||||||||||||||| |||||| |
|
|
| T |
31037395 |
gactaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgtaa |
31037453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 6118497 - 6118444
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
6118497 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 11799131 - 11799184
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
11799131 |
ctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 15635705 - 15635652
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || || |||||||||| |||||||| |||||||||||| |
|
|
| T |
15635705 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18258164 - 18258217
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| |||||||||||| |
|
|
| T |
18258164 |
ctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 18633959 - 18633906
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
18633959 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 35609636 - 35609587
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
35609636 |
actaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 2636671 - 2636758
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||| |||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
2636671 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctgcaaaaaaaatttgttgtttttggtccctgcaaat |
2636758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3851327 - 3851271
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
3851327 |
ctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgtaa |
3851271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 4203458 - 4203506
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| |
|
|
| T |
4203458 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 5103999 - 5103951
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
5103999 |
ctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 9179918 - 9179862
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
9179918 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaa |
9179862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10744052 - 10743996
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10744052 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
10743996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13990893 - 13990837
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| |||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
13990893 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
13990837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21124915 - 21124971
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
21124915 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
21124971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29366947 - 29366891
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
29366947 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
29366891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 34125309 - 34125365
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
34125309 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
34125365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34125630 - 34125574
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
34125630 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
34125574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||| |||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 42553644 - 42553700
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
42553644 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
42553700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 9532532 - 9532477
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
9532477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 12144909 - 12144964
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||| || |||| |||||||| || ||||| |||||||||||||| |
|
|
| T |
12144909 |
ctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 26071613 - 26071558
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
26071558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 27916761 - 27916706
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| | ||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgtaa |
27916706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 31155526 - 31155483
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
31155526 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
31155483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 3850594 - 3850544
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 14318221 - 14318179
Alignment:
| Q |
184 |
tccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
14318221 |
tccctgcaaaatattttgttttttaaaaaggtccttgcaaaat |
14318179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 23382295 - 23382245
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||| |
|
|
| T |
23382295 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 24781991 - 24782045
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
24781991 |
ctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 86
Target Start/End: Complemental strand, 24782255 - 24782217
Alignment:
| Q |
48 |
tcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24782255 |
tcctacaaatatgcctcgttttgattttagtccctgtaa |
24782217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 25561997 - 25561951
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| |
|
|
| T |
25561997 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 42207421 - 42207463
Alignment:
| Q |
184 |
tccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
42207421 |
tccctgcaaaatattttgtttttaaaaaaggtccatgcaaaat |
42207463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagt-cctacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 42994070 - 42994116
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
42994070 |
ctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3850301 - 3850358
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgtttt-gattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||| ||| ||||||| | ||||||||||||||| |
|
|
| T |
3850301 |
ctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgtaa |
3850358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 3850645 - 3850604
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaa |
224 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
3850645 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaa |
3850604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 29875402 - 29875455
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29875402 |
ctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 2032938 - 2032882
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| ||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
2032938 |
ctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
2032882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10830531 - 10830587
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| || ||||||||| | |||||| ||||||| ||||||| |
|
|
| T |
10830531 |
ctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgtaa |
10830587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14318047 - 14318103
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
14318047 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaa |
14318103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 15916288 - 15916340
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| || ||||| ||||||||||| |
|
|
| T |
15916288 |
ctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 27 - 79
Target Start/End: Original strand, 16616367 - 16616419
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| || |||| |||||||| |
|
|
| T |
16616367 |
tgactaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 23381952 - 23382008
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| ||||||| ||||||| |
|
|
| T |
23381952 |
ctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
23382008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29855615 - 29855671
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| | || |||||||| || ||||| ||||||||||||||| |
|
|
| T |
29855615 |
ctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaa |
29855671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31037739 - 31037683
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| || |||||| |
|
|
| T |
31037739 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgtaa |
31037683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 32109094 - 32109039
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||||| ||||||| | |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
32109094 |
ctaatatatgattttggt-cgtgcaaatatgtttcgttttggttttagtccctgtaa |
32109039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 36278083 - 36278139
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||| |||| ||||||||| ||||| |
|
|
| T |
36278083 |
ctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtccatgtaa |
36278139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 38182085 - 38182045
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38182085 |
ctaaaatatggttttggtttctgcaaatatgtctcgttttg |
38182045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 38189046 - 38189086
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38189046 |
ctaaaatatggttttggtttctgcaaatatgtctcgttttg |
38189086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 38209311 - 38209271
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38209311 |
ctaaaatatggttttggtttctgcaaatatgtctcgttttg |
38209271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 38216271 - 38216311
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38216271 |
ctaaaatatggttttggtttctgcaaatatgtctcgttttg |
38216311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 38555081 - 38555030
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| || ||||| ||||||||||| |
|
|
| T |
38555081 |
ctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40029143 - 40029199
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||| ||||||| |||||||| ||||| ||||||||| |
|
|
| T |
40029143 |
ctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaa |
40029199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 40168006 - 40167950
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40168006 |
ctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaa |
40167950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 42207244 - 42207300
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | || ||||||| |||||||| ||||||||||||||| |
|
|
| T |
42207244 |
ctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaa |
42207300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 248)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 52543599 - 52543504
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52543599 |
atgatttgcacacgtgtcacatgatgactgaatccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
52543504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 122 - 227
Target Start/End: Complemental strand, 42823971 - 42823866
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgc |
221 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
42823971 |
catttttgtgatgatttgcacatgtgacacatgatgactgaactcatttattagaaaaatagtccctgcaaaatcttttaatttttaaaaaggtccctgc |
42823872 |
T |
|
| Q |
222 |
aaaata |
227 |
Q |
| |
|
|||||| |
|
|
| T |
42823871 |
aaaata |
42823866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 4211631 - 4211726
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4211631 |
atgatttgcacacgtggcacatgatgattgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaatgtccctgcaaaata |
4211726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 35119294 - 35119488
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnn--gttgtttttggtccctgcaaatgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||| |||||| |||||| ||| | || ||| |
|
|
| T |
35119294 |
ctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaatttttttttttgttgttcttggtctctgtc-----cccacttt |
35119388 |
T |
|
| Q |
128 |
ggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|| |||||||||||| ||| ||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35119389 |
tgtgatgatttgcacacgtggtacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
35119488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 5203163 - 5203068
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
5203163 |
atgatttgcacatgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgtaaaata |
5203068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 14791736 - 14791641
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14791736 |
atgatttgcacacttgacacttgatgattgaacccatttattagaaaaatagtccctgtaaaatcttttgatttttaaaaaggtccttgcaaaata |
14791641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 12791844 - 12791749
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||| ||||| | ||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
12791844 |
atgatttgcacacgtgacacatgatgactgaacccaattattagtaaaatagtccctgcaaaatattttgatttttaaaaaggtccctgcaaaata |
12791749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 13073890 - 13073985
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13073890 |
atgatttgcacacgtggtacatgatgaccgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
13073985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 24774297 - 24774202
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
24774297 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
24774202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 25424182 - 25424087
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25424182 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
25424087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 31182255 - 31182349
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | ||||||| ||||||||||||||| |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31182255 |
atgatttgcacacgtgacacatgatgattgaa-ctatttattagaaaaatagtccctgtaaaatcttttgattttgaaaaaggtccctgcaaaata |
31182349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 2034724 - 2034630
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
2034724 |
atgatttgcacacgtggcacatgatgactgaatccatttattagaaaa-tagtccctgcaaaatcttttgattttgaaaaaggcccctgcaaaata |
2034630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 5827785 - 5827879
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| ||||| |||||||||| |||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5827785 |
atgatttgcatatgtggcacatgatgagtgaactcatttattagaaaaatagtccctgcaaaatcttttgatttgtaaaaaggtcc-tgcaaaata |
5827879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 14488057 - 14487962
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
14488057 |
atgatttgcacacgtggcacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
14487962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 19903391 - 19903486
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| | ||||||| |||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
19903391 |
atgatttgcacatgtggcacatgatgagtgaaccaatttattaaaaaaatagtccctgcaaaatcttttgatttgtataaaggtccctgcaaaata |
19903486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 46115649 - 46115554
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
46115649 |
atgatttgcacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
46115554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 46128783 - 46128688
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
46128783 |
atgatttgcacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
46128688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 54903346 - 54903251
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| ||||||||| || | |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54903346 |
atgatttgcaagcgtgacacataataactgaatccatttattagaaaaatagttcctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
54903251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 132 - 226
Target Start/End: Complemental strand, 5797690 - 5797596
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
5797690 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtcactgcaaaat |
5797596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 2322302 - 2322217
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
2322302 |
atgatttgcacacgtgacacatgacgaccgaatccatttattagaaaaatagttcctgtaaaatcttttgatttttaaaaaggtcc |
2322217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 227
Target Start/End: Complemental strand, 8905115 - 8905010
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgc |
221 |
Q |
| |
|
|||||| || |||||||||||| ||||||||| |||| ||||||||||||| |||||||| |||||||||||| |||||||||||||||| |||| | | |
|
|
| T |
8905115 |
catttttgtgatgatttgcacacgtgacacataatgaccgaatccatttattagaaaaataatccctgcaaaatattttgatttttaaaaaagtccctac |
8905016 |
T |
|
| Q |
222 |
aaaata |
227 |
Q |
| |
|
|||||| |
|
|
| T |
8905015 |
aaaata |
8905010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 20292188 - 20292103
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||| || ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20292188 |
atgatttgcacacgtgacacatgatgattaaactcatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtcc |
20292103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 122 - 226
Target Start/End: Complemental strand, 30565078 - 30564974
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgc |
221 |
Q |
| |
|
|||||| || |||||||||||| | |||| | ||||| |||| | ||||||| |||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
30565078 |
catttttgtaatgatttgcacacgcgacatacgatgactgaacctatttattagaaaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgc |
30564979 |
T |
|
| Q |
222 |
aaaat |
226 |
Q |
| |
|
||||| |
|
|
| T |
30564978 |
aaaat |
30564974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 7642523 - 7642440
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7642523 |
atgatttgcacacgtggcacatgatgactgaactcatttattagaaaaatagtccctgtaaaatcttttgatttttaaaaaggt |
7642440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 47022975 - 47022880
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
47022975 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttaattttgaaaaaggtctctgcaaaata |
47022880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 53307884 - 53307979
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| |||||| ||||| | ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
53307884 |
atgatttacacacgtgacatatgataaccgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggttcttgcaaaata |
53307979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 53915685 - 53915788
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
53915685 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
53915784 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
53915785 |
ggtt |
53915788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 29499413 - 29499322
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
29499413 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
29499322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 30060902 - 30060993
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
30060902 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
30060993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 31560464 - 31560555
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31560464 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
31560555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 35464249 - 35464158
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35464249 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35464158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 42848258 - 42848167
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
42848258 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccttgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
42848167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 53915816 - 53915907
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
53915816 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
53915907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 12152363 - 12152268
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||| ||| |||| ||||| |||| |||||||| |||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12152363 |
atgatttgcactcgtggcacacgatgactgaactcatttattagaaagatagtctctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
12152268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 47135908 - 47136002
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||| ||| || |||||| |
|
|
| T |
47135908 |
atgatttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaagatccctgtaaaata |
47136002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 31812053 - 31812127
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
31812053 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctccaaaatcttttgatttt |
31812127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 23245233 - 23245336
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
23245233 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
23245332 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
23245333 |
ggtt |
23245336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 31560333 - 31560436
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
31560333 |
ctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
31560432 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
31560433 |
ggtt |
31560436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 35464380 - 35464277
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35464380 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35464281 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35464280 |
ggtt |
35464277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 42848389 - 42848286
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
42848389 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
42848290 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
42848289 |
ggtt |
42848286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 23245364 - 23245455
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| || |||||||||| |||| ||||||||| || ||||||||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
23245364 |
atttgcacacatgtcacatgatgactgaa-ccatttattagagaaatagtccttgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
23245455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 26412451 - 26412360
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
26412451 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccatgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
26412360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 29499543 - 29499441
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcattttg |
29499444 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
29499443 |
gtt |
29499441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 30060772 - 30060874
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctgcaatatttttttgttgtttttggtccctgcaaatatgtctcattttg |
30060871 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
30060872 |
gtt |
30060874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 11692891 - 11692986
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| || | ||| |||||||||| |||| ||||||||| ||||||||| | ||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
11692891 |
atgattttcatacgtggcacatgatgactgaacccatttattagaaaaatagcctctgcaaaatcttttgatttttaaaaagttctctgcaaaata |
11692986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 13530711 - 13530625
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13530711 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
13530625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 19321857 - 19321771
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19321857 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19321771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 26314120 - 26314214
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| || | ||||||| |||| ||||||||| ||||||||||| || ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26314120 |
atgatttgcacatctgcaatatgatgactgaacccatttattacaaaaatagtccttgtaaaatcttttgatttttaaaaaggtcc-tgcaaaata |
26314214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 41439918 - 41440012
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||| ||||| ||||||||| || |||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
41439918 |
atgatttgcacacgtggcacatgatgactgaacccaattattagaaaaatagaccttgcaaaattttttgatttttaaaaa-gtccctgcaaaata |
41440012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 43200100 - 43200194
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||| || ||||| ||||||||||||| ||| ||||| ||||| |||| ||||||||| |
|
|
| T |
43200100 |
atgatttgcacatgtgacatatgatgactgaacccatttattagagaaataatccctgcaaaatc-tttaattttgaaaaaagtccttgcaaaata |
43200194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 43231387 - 43231301
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43231387 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
43231301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 54208695 - 54208601
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||| |||| ||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
54208695 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaattgtcc-tgcaaaatcttttcattttcaaaaaggtccttgcaaaata |
54208601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 13631597 - 13631489
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
13631597 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
13631498 |
T |
|
| Q |
128 |
ggttatgat |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
13631497 |
ggttttgat |
13631489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 37557193 - 37557104
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgt |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
37557193 |
ctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaatttttttttgttgtttttggtccctccaaatgt |
37557104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 25424310 - 25424207
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
25424310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
25424211 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
25424210 |
ggtt |
25424207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 26412582 - 26412479
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
26412582 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
26412483 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
26412482 |
ggtt |
26412479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 43231090 - 43231193
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
43231090 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
43231189 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
43231190 |
ggtt |
43231193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 51763072 - 51762987
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||| ||||||||| || ||||||| | ||||||||||||||||||| | |||||||| |
|
|
| T |
51763072 |
atgatttgcacacgtgacaaatgatgactgaacccatttattagagaaatagttcatgcaaaatcttttgattttgagaaaggtcc |
51762987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11693119 - 11693063
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11693119 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
11693063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13064161 - 13064217
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13064161 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
13064217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 13631466 - 13631375
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| ||| ||||||||| || ||||||||| ||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
13631466 |
atttgcacacgtggcacatgatgaccgaa-ccatttattagagaaatagtccttgcaaaatcttttcattttgaaaaaggtccctgcaaaata |
13631375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 24774047 - 24774103
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24774047 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24774103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31812211 - 31812155
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31812211 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
31812155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 37557036 - 37556976
Alignment:
| Q |
167 |
atttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
37557036 |
atttattagaaaaatagtccctgcaaaatcttctgatttttaaaaaggtctttgcaaaata |
37556976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 42848029 - 42848085
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42848029 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
42848085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 46115416 - 46115472
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
46115416 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46115472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 46128550 - 46128606
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
46128550 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46128606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 55072391 - 55072447
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55072391 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
55072447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 13631230 - 13631316
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13631230 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
13631316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 14487804 - 14487890
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14487804 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
14487890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 19321703 - 19321773
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
19321703 |
atttgcacacgtgacacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttcatttt |
19321773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 25423926 - 25424012
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25423926 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
25424012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 195
Target Start/End: Original strand, 29380738 - 29380801
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaat |
195 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29380738 |
atgatttgcacacgtggcacatgatgactgaatccatttattagaaaaatagtccctccaaaat |
29380801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 29499184 - 29499270
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
29499184 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
29499270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 30046790 - 30046704
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30046790 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
30046704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 30061131 - 30061045
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30061131 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
30061045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35464020 - 35464106
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35464020 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35464106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 13530509 - 13530583
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
13530509 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgttttt |
13530583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 14594420 - 14594342
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||| || ||| |||||||| ||| ||||||||| |
|
|
| T |
14594420 |
cacatgatgagtgaatccatttattagaaaaatagtctatgcaaaatctctttattcttaaaaagatccctgcaaaata |
14594342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 27 - 116
Target Start/End: Complemental strand, 19903656 - 19903567
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19903656 |
tgactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaa |
19903567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 43368465 - 43368523
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
43368465 |
gactaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
43368523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 46292462 - 46292536
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||||||| | ||||||||||||||||||||| ||||| |||| |
|
|
| T |
46292462 |
atgatttgcacacgtgacacatgatgactaaatccattttgtagaaaaatagtccctgcaaaatattttgttttt |
46292536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 11219562 - 11219473
Alignment:
| Q |
134 |
gatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
|||||||||| |||||| ||||||| || ||| ||||||| || |||||||||||| | |||||||| ||||| |||||||||| ||||| |
|
|
| T |
11219562 |
gatttgcacacgtgacaaatgatgactggatctatttattagagaaatagtccctggataatcttttaattttgaaaaaggtccttgcaa |
11219473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 11230069 - 11229980
Alignment:
| Q |
134 |
gatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
|||||||||| |||||| ||||||| || ||| ||||||| || |||||||||||| | |||||||| ||||| |||||||||| ||||| |
|
|
| T |
11230069 |
gatttgcacacgtgacaaatgatgactggatctatttattagagaaatagtccctggataatcttttaattttgaaaaaggtccttgcaa |
11229980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 13530381 - 13530484
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
13530381 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaatatgcctcatttt |
13530480 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
13530481 |
ggtt |
13530484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 132 - 197
Target Start/End: Original strand, 36050416 - 36050481
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatct |
197 |
Q |
| |
|
|||||||||||| ||| || ||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
36050416 |
atgatttgcacacgtggcatatgatgactgaacccatttattagaaaaatagtccctgcaaaatct |
36050481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 5827971 - 5827915
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5827971 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaa |
5827915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6353636 - 6353580
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
6353636 |
ctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
6353580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13064463 - 13064407
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13064463 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13064407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13073761 - 13073817
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13073761 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13073817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 14488185 - 14488098
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14488185 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaat |
14488098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 16712689 - 16712633
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16712689 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16712633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 20144549 - 20144617
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
||||| |||||| ||| |||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
20144549 |
atgatatgcacacgtggtacatgatgattgaactcatttattagaaaaatagtccctgcaaaatctttt |
20144617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 36702002 - 36702058
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36702002 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
36702058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 36702361 - 36702305
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
36702361 |
ctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaa |
36702305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 52017507 - 52017563
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52017507 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52017868 - 52017812
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52017868 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 52441765 - 52441821
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52441765 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
52441821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 53717172 - 53717116
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
53717172 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
53717116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 54903473 - 54903417
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
54903473 |
ctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
54903417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 31560693 - 31560607
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31560693 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
31560607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 35420393 - 35420448
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||| |||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 38054549 - 38054604
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38054604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 227
Target Start/End: Complemental strand, 44925675 - 44925624
Alignment:
| Q |
176 |
aaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
44925675 |
aaaaatagtccttgcaaaatcttttaatttttaaaaaggtccctgcaaaata |
44925624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 51545966 - 51545911
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
51545911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 51762872 - 51762958
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51762872 |
ctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
51762958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 2034853 - 2034749
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa-nnnnnnnnngttgtttttggtccctgcaa--atgtctcattt |
126 |
Q |
| |
|
||||||||||||||| || || |||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
2034853 |
ctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaatatgtctcattt |
2034754 |
T |
|
| Q |
127 |
tggtt |
131 |
Q |
| |
|
||||| |
|
|
| T |
2034753 |
tggtt |
2034749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 9445949 - 9446007
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9445949 |
gactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9446007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 2034544 - 2034597
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2034597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 2322095 - 2322179
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgca |
114 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2322095 |
ctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaaaaatttttgttgtttttggtccctgca |
2322179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 2322430 - 2322327
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||| ||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
2322430 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaatatgtctcgtttt |
2322331 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
2322330 |
ggtt |
2322327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 4211563 - 4211616
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
4211563 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 14791804 - 14791751
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
14791804 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 19321572 - 19321675
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| |||| ||| |||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
19321572 |
ctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatttt |
19321671 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
19321672 |
ggtt |
19321675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 19903263 - 19903366
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||| |||||| | |||||||||||| || ||||||||||||||||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
19903263 |
ctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaattttttgttgttgtttttgatccctgcaaatatgtctcatttt |
19903362 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
19903363 |
ggtt |
19903366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 30564833 - 30564890
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || |||||| |||||||||||||| |
|
|
| T |
30564833 |
gactaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 35415631 - 35415578
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
35415631 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 35763649 - 35763702
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
35763649 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 41345855 - 41345908
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
41345855 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 46292394 - 46292447
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
46292394 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 47023103 - 47023050
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
47023103 |
ctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 51738409 - 51738356
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
51738409 |
ctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 51763200 - 51763097
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| || ||||| ||||||| ||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
51763200 |
ctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaattttttttgttgtttttggtccctgcaaatatgcctcatttt |
51763101 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
51763100 |
ggtt |
51763097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 53308075 - 53308010
Alignment:
| Q |
21 |
ttaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| || |||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
53308075 |
ttaagctggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaa |
53308010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 2180222 - 2180278
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
2180222 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
2180278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5827657 - 5827713
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
5827657 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
5827713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5882554 - 5882609
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5882554 |
ctaaaatatggttttagt-cctgcaaatatgcctcgttttggttttagtccctgtaa |
5882609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11285505 - 11285561
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11285505 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11285561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 11692764 - 11692816
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
11692764 |
ctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12152491 - 12152435
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
12152491 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaa |
12152435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12791972 - 12791916
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12791972 |
ctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13074123 - 13074067
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||| ||||||||| ||||| |
|
|
| T |
13074123 |
ctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaa |
13074067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13479609 - 13479553
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13479609 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13479553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13764615 - 13764671
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
13764615 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaa |
13764671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13764805 - 13764749
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
13764805 |
ctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaa |
13764749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 18205158 - 18205210
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
18205158 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20144729 - 20144673
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
20144729 |
ctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaa |
20144673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20291988 - 20292044
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
20291988 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
20292044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22099545 - 22099601
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
22099545 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22099601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 22584605 - 22584549
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22584605 |
ctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaa |
22584549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 23245593 - 23245537
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
23245593 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
23245537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26313990 - 26314046
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
26313990 |
ctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaa |
26314046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 28809178 - 28809126
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
28809178 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 29420535 - 29420483
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
29420535 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29463911 - 29463855
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
29463911 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaa |
29463855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 31811927 - 31811983
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31811927 |
ctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaa |
31811983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 32208544 - 32208596
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
32208544 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 32208899 - 32208847
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
32208899 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 36050290 - 36050346
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36050290 |
ctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaa |
36050346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 36054148 - 36054092
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
36054148 |
ctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
36054092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 41324888 - 41324832
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
41324888 |
ctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaa |
41324832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 42824089 - 42824033
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
42824089 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaa |
42824033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 44925843 - 44925787
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44925843 |
ctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaa |
44925787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45474594 - 45474538
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||| |||||||| |||||| |
|
|
| T |
45474594 |
ctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgtaa |
45474538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 50754118 - 50754058
Alignment:
| Q |
140 |
cacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
50754118 |
cacacgtgacacatgatgactgaactcatttattagaaaaatagtccctgcaaaatatttt |
50754058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 14791502 - 14791557
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||| |||||||| |||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
14791557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 20144423 - 20144478
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaa |
20144478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 86
Target Start/End: Complemental strand, 35420704 - 35420645
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
35420704 |
tgactaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaa |
35420645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 53916045 - 53915959
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
53916045 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaa |
53915959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 54208822 - 54208767
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
54208767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 55072709 - 55072654
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
55072654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 18205523 - 18205465
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
18205523 |
gactaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18205465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 27008086 - 27008140
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27008086 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 34 - 80
Target Start/End: Original strand, 31182133 - 31182179
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31182133 |
aatatggttttggttagtgcaaatatgcttcattttgattttagtcc |
31182179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 32365096 - 32365150
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
32365096 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 32365481 - 32365427
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32365481 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 45505602 - 45505656
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
45505602 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 45505892 - 45505838
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
45505892 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 47022743 - 47022828
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||||| | |||||||||| |||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaa |
47022828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 123536 - 123589
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||||||| |
|
|
| T |
123536 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 6827872 - 6827819
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
6827872 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 7642650 - 7642548
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| || |||| ||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
7642650 |
ctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaattttttgtt-ttgtttttggtccctgcaaatatgtctcatttt |
7642552 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
7642551 |
ggtt |
7642548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 9289268 - 9289321
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
9289268 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 26412192 - 26412245
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||||||||| |
|
|
| T |
26412192 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 27008401 - 27008348
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
27008348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 35415301 - 35415354
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
35415301 |
ctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 165 - 210
Target Start/End: Original strand, 35420543 - 35420588
Alignment:
| Q |
165 |
ccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaa |
210 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35420543 |
ccatttattagaaaaatagtctctgcaaaatattttgatttttaaa |
35420588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 41620254 - 41620201
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
41620254 |
ctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 43368784 - 43368719
Alignment:
| Q |
21 |
ttaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||| ||||||||||||||| |||| ||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
43368784 |
ttaatatggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgtaa |
43368719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 46088058 - 46088005
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
46088058 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 50714242 - 50714295
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||||||| |
|
|
| T |
50714242 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 50714563 - 50714510
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
50714563 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 25 - 117
Target Start/End: Complemental strand, 55805091 - 55804999
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||| ||||||||| |||||||||| ||||||||||| | |||||| ||||||||| || || |||||||||||||||||||||| |
|
|
| T |
55805091 |
gatggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtccatgcaaattttttttgttgtttttggtccctgcaaat |
55804999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 5052578 - 5052526
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
5052578 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
5052526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcg-ttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 5797817 - 5797715
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||| ||||| |||||| || |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgcctcattttg |
5797718 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
5797717 |
gtt |
5797715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 8191389 - 8191333
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||| | ||| ||||||||||| |
|
|
| T |
8191389 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
8191333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 8760779 - 8760723
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8760779 |
ctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaa |
8760723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 8905232 - 8905180
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| || ||||||||||| ||||| |
|
|
| T |
8905232 |
ctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12152156 - 12152212
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
12152156 |
ctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaa |
12152212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 22099910 - 22099854
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
22099910 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
22099854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 23778966 - 23779014
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| |
|
|
| T |
23778966 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 24474602 - 24474657
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
24474602 |
ctaaaatatggttttagt-cctgcaaatatgcatcgttttggttttagtccatgtaa |
24474657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 24474961 - 24474909
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||| |
|
|
| T |
24474961 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26314330 - 26314274
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||| ||||||| |||||||| ||||||||||||||| |
|
|
| T |
26314330 |
ctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaa |
26314274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28449212 - 28449156
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
28449212 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgtaa |
28449156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 28809013 - 28809069
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28809013 |
ctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaa |
28809069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29380908 - 29380852
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
29380908 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
29380852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31182502 - 31182446
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
31182502 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaa |
31182446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 34361805 - 34361861
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
34361805 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
34361861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 42823778 - 42823834
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
42823778 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaa |
42823834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 46115777 - 46115690
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
||||||||||||||| || |||||||||| | |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
46115777 |
ctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaat |
46115690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 46128911 - 46128824
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
||||||||||||||| || |||||||||| | |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
46128911 |
ctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaat |
46128824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 46292649 - 46292593
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||| |||||| |
|
|
| T |
46292649 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgtaa |
46292593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 47136169 - 47136113
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
47136169 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
47136113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 51545631 - 51545687
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| | |||||||| |||||||| |||||| |
|
|
| T |
51545631 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgtaa |
51545687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 51738139 - 51738195
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||| ||||| ||||||||| |
|
|
| T |
51738139 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaa |
51738195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52430098 - 52430042
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
52430098 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
52430042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52442090 - 52442034
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52442090 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
52442034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52543725 - 52543669
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgtaa |
52543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 55482466 - 55482410
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
55482466 |
ctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaa |
55482410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 5797484 - 5797539
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaa |
5797539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 27 - 86
Target Start/End: Original strand, 16712328 - 16712387
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
16712328 |
tgactaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgtaa |
16712387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 20878884 - 20878927
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
20878884 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
20878927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 23254561 - 23254518
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
23254561 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
23254518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 42306095 - 42306138
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
42306095 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
42306138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 45593404 - 45593447
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
45593404 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
45593447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Complemental strand, 2180394 - 2180352
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
2180394 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
2180352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 8904888 - 8904934
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
8904888 |
ctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 9289634 - 9289584
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
9289634 |
aaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 83
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctg |
11692876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 18831178 - 18831120
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| | |||||| ||||||||||||||| |
|
|
| T |
18831178 |
gactaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaa |
18831120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 29463612 - 29463658
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
29463612 |
ctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 41921082 - 41921032
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||| ||||||||| |
|
|
| T |
41921082 |
ctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 6827548 - 6827597
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||| |
|
|
| T |
6827548 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||| || |||| ||||||||||||||||| ||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagt-cctgtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 25358538 - 25358485
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25358538 |
ctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 35763953 - 35763900
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || |||||| |||||| |||||||| |||||||||||| |
|
|
| T |
35763953 |
ctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 44925487 - 44925536
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||||| |
|
|
| T |
44925487 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 47532667 - 47532614
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaa |
47532614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||| || |||| ||||||||||||||||| ||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagt-cctgtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 51708695 - 51708744
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |
|
|
| T |
51708695 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 51709025 - 51708976
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||| |
|
|
| T |
51709025 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 33 - 81
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
|||||||||||| || ||||||||||||| || ||||| |||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4279333 - 4279277
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
4279333 |
ctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaa |
4279277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 8760606 - 8760662
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8760606 |
ctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
8760662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 9289442 - 9289486
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||||||||| |
|
|
| T |
9289442 |
gtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaata |
9289486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 13479274 - 13479326
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||||| |
|
|
| T |
13479274 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22584289 - 22584345
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| |||||||| |||||| |
|
|
| T |
22584289 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgtaa |
22584345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34355281 - 34355225
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||| |||||||| ||||||||||||||| |
|
|
| T |
34355281 |
ctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaa |
34355225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 45593230 - 45593286
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || ||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
45593230 |
ctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaa |
45593286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45593584 - 45593528
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
45593584 |
ctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaa |
45593528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 47274228 - 47274180
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
47274228 |
ctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || |||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 51738341 - 51738273
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||| |||||| | |||||||||||| |||| |
|
|
| T |
51738341 |
atgatttgcacacgtggcacatgatgactgaacttatttattagaaaaacactccctgcaaaatatttt |
51738273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 53716923 - 53716979
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
53716923 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
53716979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 16853 - 16948
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16853 |
atgatttgcacatgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtctctgcaaaata |
16948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 16726 - 16782
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16726 |
ctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
16782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 217)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 14847955 - 14848050
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
14847955 |
atgatttgcacatgtgacacatgatgagtgaacccatttattagaaaaatagtccctgcaaaatcttttgatttgtaaaaacgtccctgcaaaata |
14848050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 24090249 - 24090344
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24090249 |
atgatatgcacatgtgacacatgatgaccgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
24090344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 28497384 - 28497479
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28497384 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
28497479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 1778694 - 1778789
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
1778694 |
atgatttgcacacgtggcacatgatgactgaatccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
1778789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 9175242 - 9175147
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
9175242 |
atgatttgcacacatggcacatgatgactgaacccatttatttgaaaaatagtccctgcaaaatcttttgatttttagaaaggtccctgcaaaata |
9175147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 13232328 - 13232423
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
13232328 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
13232423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 15931139 - 15931044
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
15931139 |
atgatttgcacacgtgtcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtgcctgcaaaata |
15931044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 29992171 - 29992076
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| |||||||||||||| |||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29992171 |
atgatttacacacgtgacacatgatgactgaacccatttatttaaaaaataatccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
29992076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 2356015 - 2356110
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||| |||||||| |||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
2356015 |
atgatttgcacacatgacacatgatgactgaacccatttattagaaaaataatccctgcaaaatcttttgatttttaaaaagatccttgcaaaata |
2356110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 8298717 - 8298812
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8298717 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
8298812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 23939677 - 23939772
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||| |||||||| || |||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
23939677 |
atgatttgcacatgtgacacatgatgactgaactcatttattagaaaaataatcactgcaaaatcttttgatttttaaaaaagtccctgcaaaata |
23939772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 122 - 227
Target Start/End: Complemental strand, 42430000 - 42429895
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgc |
221 |
Q |
| |
|
|||||| || |||||||||||| ||| |||||||||| |||| ||||||| | ||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
42430000 |
catttttgtgatgatttgcacacgtggcacatgatgactgaacccatttaatagaaaaatagtccctgcaaaatcttttgatttttaaaaagatcccggc |
42429901 |
T |
|
| Q |
222 |
aaaata |
227 |
Q |
| |
|
|||||| |
|
|
| T |
42429900 |
aaaata |
42429895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 132 - 216
Target Start/End: Complemental strand, 35115569 - 35115485
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
216 |
Q |
| |
|
|||||||||| | |||||||||||||| |||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35115569 |
atgatttgcatacgtgacacatgatgactgaacccatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtc |
35115485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 4473834 - 4473929
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
4473834 |
atgatttgcacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
4473929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 7420360 - 7420455
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||| |||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
7420360 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtctctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
7420455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 30969628 - 30969534
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||| ||||||||||| || ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30969628 |
atgatttgcacatatgacacatgatgattgaacccgtttattagaaaaatagtcgct-aaaaatcttttgatttttaaaaaggtccctgcaaaata |
30969534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 223
Target Start/End: Complemental strand, 36044661 - 36044570
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36044661 |
atgatttgcacatgtgatacatgatgactgaacttatttattacaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaa |
36044570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 44998135 - 44998040
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||| | || |||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
44998135 |
atgatttgcacacgtggcacatgatgactgaatccatttattatagaagtagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
44998040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 132 - 222
Target Start/End: Original strand, 7326216 - 7326306
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7326216 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgca |
7326306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 122 - 224
Target Start/End: Complemental strand, 9832438 - 9832336
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgc |
221 |
Q |
| |
|
|||||| || ||||||| |||||||| |||||||||| || | ||||||||| |||||||||| |||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
9832438 |
catttttgtgatgatttacacatgtggcacatgatgaatgtacccatttattagaaaaatagtacctgcaaaatcttttgatttttgaaaaggtccctgc |
9832339 |
T |
|
| Q |
222 |
aaa |
224 |
Q |
| |
|
||| |
|
|
| T |
9832338 |
aaa |
9832336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 133 - 227
Target Start/End: Original strand, 13155017 - 13155111
Alignment:
| Q |
133 |
tgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||| ||| |||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
13155017 |
tgatttgcacacgtggcacatgatgactgaatccatttattaagaaaatagtccctacaaaatcttttgatttttaaaaagatccctgcaaaata |
13155111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 129 - 227
Target Start/End: Original strand, 24814832 - 24814930
Alignment:
| Q |
129 |
gttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||| | |||||||||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
24814832 |
gttatgatttgcacacgtagcacatgatgactgaatccatttaatagaaaaatagtccctataaaatctattgatttttaaaaaggtccctgcaaaata |
24814930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 10873151 - 10873055
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccattt-atttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||| ||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
10873151 |
atgatttgcacacgtggcacatgatgactgaacccattttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
10873055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 20984279 - 20984370
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20984279 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
20984370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 17074038 - 17073943
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| ||||||||||||||||| ||| || |||||||||||||| ||| ||||||||| |
|
|
| T |
17074038 |
atgatttgcacacgtgacacatgatgactgaactcatttattagaaaaatagtccctgcataatattctgatttttaaaaagatccttgcaaaata |
17073943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 17574232 - 17574327
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| ||||||||||||||||| ||| || |||||||||||||| ||| ||||||||| |
|
|
| T |
17574232 |
atgatttgcacacgtgacacatgatgactgaactcatttattagaaaaatagtccctgcataatattctgatttttaaaaagatccttgcaaaata |
17574327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 28324052 - 28323969
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28324052 |
atgatttacacacgtggcacatgatgattgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggt |
28323969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 9496721 - 9496618
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
9496721 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
9496622 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
9496621 |
ggtt |
9496618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 37536417 - 37536314
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
37536417 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
37536318 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
37536317 |
ggtt |
37536314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 2728464 - 2728373
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2728464 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
2728373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 3512133 - 3512042
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
3512133 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
3512042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 4710039 - 4710130
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
4710039 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccttgcaaaata |
4710130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 11019653 - 11019744
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
11019653 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccttgcaaaata |
11019744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 11976603 - 11976512
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
11976603 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
11976512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 33 - 131
Target Start/End: Complemental strand, 29992295 - 29992196
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt-aannnnnnnnngttgtttttggtccctgcaaatgtctcattttggtt |
131 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29992295 |
aaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaatgtctcattttggtt |
29992196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 32726138 - 32726047
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
32726138 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
32726047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 34963433 - 34963524
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
34963433 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
34963524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 35097559 - 35097468
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35097559 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35097468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 35346762 - 35346853
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35346762 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35346853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 13779405 - 13779311
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||| || |||| |||||||| |||||||||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
13779405 |
atgatttgcacatgtggcacatgtagactgaactcatttattagaaaaatagtccctgcaaaatcttttga-ttttaaaaagatccctgcaaaata |
13779311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 13796366 - 13796461
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| |||| ||||||||| | || |||||||| |||||||||||||||||||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
13796366 |
atgatttacacacgtgatacatgatgactaaactcatttattagaaaaatagtccctgcaaaatcttttaatttttaaaaaggttcctgcaaaata |
13796461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 23360501 - 23360596
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| || |||||||||||| | |||| | |||||||||| | |||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
23360501 |
atgatttgcacatgtggcatatgatgattgaacctattttgtagaaaaatagttcttgcaaaatattttgatttttaaaaaggtccctgcaaaata |
23360596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 25600361 - 25600456
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
25600361 |
atgatttgcacacatgacacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgattttgaaaattgtccctgcaaaata |
25600456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 3680738 - 3680668
Alignment:
| Q |
157 |
gattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3680738 |
gattgaactcattttttagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
3680668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 135 - 217
Target Start/End: Complemental strand, 10337316 - 10337235
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10337316 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtcc |
10337235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 32726269 - 32726161
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
32726269 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
32726170 |
T |
|
| Q |
128 |
ggttatgat |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
32726169 |
ggttttgat |
32726161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 2728595 - 2728492
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
2728595 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
2728496 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
2728495 |
ggtt |
2728492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 217
Target Start/End: Original strand, 10540579 - 10540663
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| ||| ||||||||| | ||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10540579 |
atgatttgcacacgtggcacatgatgct-gaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtcc |
10540663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 20984148 - 20984251
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
20984148 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
20984247 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
20984248 |
ggtt |
20984251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 28346756 - 28346653
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
28346756 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaatatgtctcatttt |
28346657 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
28346656 |
ggtt |
28346653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 34963302 - 34963405
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
34963302 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
34963401 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
34963402 |
ggtt |
34963405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 35097690 - 35097587
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35097690 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35097591 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35097590 |
ggtt |
35097587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 1162904 - 1162964
Alignment:
| Q |
23 |
aagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1162904 |
aagatggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 9496590 - 9496499
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
9496590 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttcattttgaaaaaggtccctgcaaaata |
9496499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10540780 - 10540724
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10540780 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
10540724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 25702736 - 25702645
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||||| ||||||| || ||||||||| ||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
25702736 |
atttgcacacgtggcacatgatgactgaatc-atttattagagaaatagtccgtgcaaaatcttttcattttgaaaaaggtccctgcaaaata |
25702645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 28346625 - 28346534
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
28346625 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatctttttattttgaaaaaggtccctgcaaaata |
28346534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 203
Target Start/End: Complemental strand, 4621224 - 4621153
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgat |
203 |
Q |
| |
|
|||||||||||| || ||||||||||| |||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
4621224 |
atgatttgcacacgtcacacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgat |
4621153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 20277822 - 20277917
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||| | |||| |||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
20277822 |
atgatttgaacacgtggcacatgataactgaactcatttattaaaaaaatagtccctgcaaaatcttttgatttttaaaaaggaacctgcaaaata |
20277917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 21064449 - 21064544
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||| | |||| |||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
21064449 |
atgatttgaacacgtggcacatgataactgaactcatttattaaaaaaatagtccctgcaaaatcttttgatttttaaaaaggaacctgcaaaata |
21064544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 3512264 - 3512161
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
3512264 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
3512165 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
3512164 |
ggtt |
3512161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 7326088 - 7326191
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
7326088 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
7326187 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
7326188 |
ggtt |
7326191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 8298589 - 8298692
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
8298589 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
8298688 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
8298689 |
ggtt |
8298692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 11019522 - 11019625
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
11019522 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
11019621 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
11019622 |
ggtt |
11019625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7326419 - 7326363
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7326419 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7326363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11976375 - 11976431
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11976375 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11976431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 11976733 - 11976631
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtctcattttg |
11976634 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
11976633 |
gtt |
11976631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40844158 - 40844214
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40844158 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
40844214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 2811571 - 2811666
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| | | ||| |||||||||| | || |||||| | || |||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
2811571 |
atgatttgtatacgtggcacatgatgactaaacccattttatagataaatagtccctgcaaaatattttgatttttaaaaaggtccctgcaaaata |
2811666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 4710218 - 4710132
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
4710218 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
4710132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 7420588 - 7420502
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7420588 |
ctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
7420502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 8298973 - 8298887
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8298973 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8298887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 10337121 - 10337207
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10337121 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
10337207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 11019855 - 11019769
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
11019855 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
11019769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 28346396 - 28346482
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28346396 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa |
28346482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 37536088 - 37536174
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
37536088 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaa |
37536174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 42133152 - 42133066
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42133152 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
42133066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 35346631 - 35346731
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35346631 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35346730 |
T |
|
| Q |
128 |
g |
128 |
Q |
| |
|
| |
|
|
| T |
35346731 |
g |
35346731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 10337447 - 10337348
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
10337447 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
10337348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 132 - 201
Target Start/End: Complemental strand, 27117906 - 27117837
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttg |
201 |
Q |
| |
|
|||||||||||| ||| ||| |||||| |||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
27117906 |
atgatttgcacacgtggcacgtgatgactgaacccatttattagagaaatagtccctgcaaaatcttttg |
27117837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4474042 - 4473986
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4474042 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
4473986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4621352 - 4621296
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4621352 |
ctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4621296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 5357761 - 5357674
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
5357761 |
ctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgtaatttttttttgttgtttttggtccctgcaaat |
5357674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6146947 - 6146891
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6146947 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
6146891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7186002 - 7185946
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7186002 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
7185946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 9175368 - 9175266
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||| |||||||| |||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaaattttttttgttgtttttggtccctgcaaatatgtctcgttttg |
9175269 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
9175268 |
gtt |
9175266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10872917 - 10872973
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10872917 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
10872973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 13232201 - 13232303
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaatattttgttgtttttagtccctgcaaatatgcctcattttg |
13232300 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
13232301 |
gtt |
13232303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 14489071 - 14489015
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14489071 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14489015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 14496818 - 14496870
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
14496818 |
ctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 16789367 - 16789311
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16789367 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16789311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 18549203 - 18549259
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18549203 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
18549259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20277694 - 20277750
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
20277694 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
20277750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21064321 - 21064377
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
21064321 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
21064377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22650466 - 22650522
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22650466 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
22650522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 24090486 - 24090430
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
24090486 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
24090430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 24187571 - 24187627
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24187571 |
ctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaa |
24187627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 25131445 - 25131393
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
25131445 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25702514 - 25702570
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
25702514 |
ctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaa |
25702570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27117755 - 27117811
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27117755 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaa |
27117811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 27341589 - 27341533
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
27341589 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
27341533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29488108 - 29488052
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29488108 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
29488052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35345615 - 35345559
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
35345615 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaa |
35345559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 43477165 - 43477221
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
43477165 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43477221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 3511908 - 3511994
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3511908 |
ctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
3511994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 5357615 - 5357548
Alignment:
| Q |
160 |
tgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||||||| || ||| ||| ||||||||| |
|
|
| T |
5357615 |
tgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaataagatccctgcaaaata |
5357548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 28497616 - 28497561
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28497561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 32725909 - 32725995
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32725909 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
32725995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 33636324 - 33636375
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||||| |
|
|
| T |
33636324 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 33652425 - 33652330
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| || |||||||| |||||||||||| || |||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
33652425 |
atgatttgcacacgtggcacatgatgacataactcatttattagaaaaatagtccttgtaaaatcttttgatttttaaataggcccctccaaaata |
33652330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35097330 - 35097416
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35097330 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
35097416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 35346996 - 35346910
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35346996 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
35346910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 44997933 - 44998019
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
44997933 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaattttttttgttgtttttggtccctgcaaa |
44998019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 14239078 - 14239024
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
14239078 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 132 - 202
Target Start/End: Original strand, 16010723 - 16010793
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttga |
202 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||||| | |||||||||| |||||||||| |||||| |
|
|
| T |
16010723 |
atgatttgtacacgtgactcatgatgattgaatccattttgtagaaaaatagttcctgcaaaatattttga |
16010793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 18549573 - 18549515
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
18549573 |
gactaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18549515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 42132994 - 42133068
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| || |||||||||| |||| |||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
42132994 |
atgatttgcacacctggcacatgatgactgaactcatttattagagaaatagtccctacaaaatcttttgatttt |
42133068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 1778566 - 1778619
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
1778566 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 7420232 - 7420285
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
7420232 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 10873278 - 10873225
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
10873278 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 19494411 - 19494358
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19494411 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 22917566 - 22917619
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
22917566 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 34963662 - 34963609
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
34963662 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 4375694 - 4375750
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
4375694 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
4375750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 5357425 - 5357477
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5357425 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7272749 - 7272693
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7272749 |
ctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaa |
7272693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 10755526 - 10755474
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10755526 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10776497 - 10776441
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
10776497 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10776441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 13154888 - 13154975
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
||||||||| |||||| | | ||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13154888 |
ctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattttcttttgttgtttttggtccctgcaaat |
13154975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13155249 - 13155193
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
13155249 |
ctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaa |
13155193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13779530 - 13779474
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
13779530 |
ctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaa |
13779474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14495071 - 14495127
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
14495071 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
14495127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 15930934 - 15930990
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
15930934 |
ctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaa |
15930990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 17073809 - 17073865
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
17073809 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17073865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 17574461 - 17574405
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
17574461 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17574405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20278055 - 20277999
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
20278055 |
ctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
20277999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20984508 - 20984452
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
20984508 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
20984452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21064682 - 21064626
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| |||||||| ||||||||| ||||| |
|
|
| T |
21064682 |
ctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
21064626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25600232 - 25600288
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
25600232 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25600288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 28323851 - 28323903
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
28323851 |
ctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28399033 - 28398977
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
28399033 |
ctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaa |
28398977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29158356 - 29158412
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29158356 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
29158412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30969400 - 30969456
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | | |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
30969400 |
ctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaa |
30969456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 32418320 - 32418376
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
32418320 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
32418376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 40066818 - 40066762
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40066818 |
ctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaa |
40066762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40492962 - 40493018
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40492962 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa |
40493018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 43727097 - 43727153
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaa |
43727153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 2728234 - 2728320
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
2728234 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
2728320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 6469282 - 6469368
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||| ||| || ||||||||||||| |||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
6469282 |
ctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaa |
6469368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 9496343 - 9496429
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
9496343 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaa |
9496429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 6469519 - 6469442
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| |||| |||| ||||||||| ||||| || || |||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
6469519 |
cacattatgactgaacccatttattagaaaattaatct-tgcaaaatcttttgatttttgaaaaggtccctgcaaaata |
6469442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 14238753 - 14238807
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
14238753 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 33526054 - 33526104
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||| ||||||||| |
|
|
| T |
33526054 |
ctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 33526410 - 33526356
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
33526410 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 1525811 - 1525860
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
1525811 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 1526170 - 1526117
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
1526170 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 3680532 - 3680585
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaa |
3680585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 4016907 - 4016960
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
4016907 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 4017298 - 4017245
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||||||| |
|
|
| T |
4017298 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 4473706 - 4473759
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||| |||||||||||| |
|
|
| T |
4473706 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 10540451 - 10540554
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||| ||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
10540451 |
ctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccctacaatttttttttgttgtttttggtccctgcaaatatgcctcatttt |
10540550 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
10540551 |
ggtt |
10540554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 13779150 - 13779207
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
13779150 |
actaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaa |
13779207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 16643663 - 16643716
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
16643663 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 16644042 - 16643989
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
16644042 |
ctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 24090121 - 24090224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||||| || | ||||| |||||||||||||||||||| ||| |||||||||||| ||||||| ||||||| |||| |
|
|
| T |
24090121 |
ctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccctataattttttgttgttgtttttggttcctgcaaatatgtctcgtttt |
24090220 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
24090221 |
ggtt |
24090224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 42132866 - 42132919
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||| |||||| |
|
|
| T |
42132866 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 6146518 - 6146574
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
6146518 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
6146574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6469665 - 6469609
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
6469665 |
ctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaa |
6469609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 7272422 - 7272478
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
7272422 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
7272478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 9175014 - 9175070
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9175014 |
ctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
9175070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 13232560 - 13232512
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||| |
|
|
| T |
13232560 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 16789077 - 16789133
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
16789077 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
16789133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 24815066 - 24815010
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
24815066 |
ctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaa |
24815010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 24955008 - 24954956
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||| |
|
|
| T |
24955008 |
ctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25131113 - 25131169
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
25131113 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25131169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25600595 - 25600539
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
25600595 |
ctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
25600539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 27117974 - 27117922
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||| |||||| |
|
|
| T |
27117974 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27341260 - 27341316
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
27341260 |
ctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtccttgtaa |
27341316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28324179 - 28324123
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| | |||||| ||||||||||||||| |
|
|
| T |
28324179 |
ctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaa |
28324123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 28497257 - 28497313
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
28497257 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaa |
28497313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 32040077 - 32040133
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| | || || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
32040077 |
ctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
32040133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40066499 - 40066555
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
40066499 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaa |
40066555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 42430118 - 42430062
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
42430118 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
42430062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 8094839 - 8094788
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||||| |
|
|
| T |
8094839 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 14488894 - 14488937
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
14488894 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
14488937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 21125721 - 21125776
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
21125721 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 23939907 - 23939852
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtccatgtaa |
23939852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 33 - 80
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| ||||||||||||| || ||||| ||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 96 - 131
Target Start/End: Original strand, 24814775 - 24814810
Alignment:
| Q |
96 |
gttgtttttggtccctgcaaatgtctcattttggtt |
131 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24814775 |
gttgattttggtccctgcaaatgtctcattttggtt |
24814810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 29991918 - 29991973
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgtaa |
29991973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 30337101 - 30337144
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
30337101 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
30337144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 135 - 206
Target Start/End: Complemental strand, 37536286 - 37536216
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
37536286 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatattttgttttt |
37536216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 40844532 - 40844477
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaa |
40844477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 42429760 - 42429845
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42429760 |
ctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
42429845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 70
Target Start/End: Original strand, 2811435 - 2811477
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2811435 |
gactaaaatatggttttggtctctgtaaatatgcttcgttttg |
2811477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 4376008 - 4375970
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttt |
68 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
4376008 |
ctaaaatatggttttagtccctgcaaatatgcttcgttt |
4375970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 83
Target Start/End: Original strand, 13154959 - 13155001
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13154959 |
ttttggtccctgcaaatatgtttcgttttgattttggtccctg |
13155001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 83
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 83
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 29487752 - 29487802
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||||||||| ||||||||| |
|
|
| T |
29487752 |
ctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 3680799 - 3680746
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
3680799 |
ctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 82
Target Start/End: Complemental strand, 4621281 - 4621240
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
4621281 |
ttttggttcctgcaaatatgcctcattttgattttggtccct |
4621240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 8094481 - 8094534
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| |||||||||||| |
|
|
| T |
8094481 |
ctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 19494121 - 19494174
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
19494121 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 19494296 - 19494341
Alignment:
| Q |
181 |
tagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||| |||||||| |
|
|
| T |
19494296 |
tagtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaat |
19494341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 24187895 - 24187842
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
24187895 |
ctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 29487932 - 29487891
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaa |
224 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
29487932 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaa |
29487891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 38930662 - 38930609
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
38930662 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 1408351 - 1408299
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || |||| ||||||||||| |
|
|
| T |
1408351 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| |||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 9832217 - 9832273
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| |||||||||||| | |||||||||| || |||||| ||||| ||||||||| |
|
|
| T |
9832217 |
ctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaa |
9832273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10776150 - 10776206
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
10776206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 15719658 - 15719714
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
15719658 |
ctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaa |
15719714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 36044790 - 36044734
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||| || |||||||| ||||| || |||||| |
|
|
| T |
36044790 |
ctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgtaa |
36044734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 43727431 - 43727376
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagt-cctgcaaatatgtctcgttttggttttagtccttgtaa |
43727376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 209)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 22540163 - 22540068
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| || ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22540163 |
atgatttgcacatttggcacatgatgattgaactcatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
22540068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 46829180 - 46829085
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46829180 |
atgatttgcacacatgacacatgatgattgaaccaatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
46829085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 24717298 - 24717393
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24717298 |
atgatttgcacacatgacacatgatgactgaacccatttattagaaaaatagtccctacaaaatcttttgatttttaaaaaggtccctgcaaaata |
24717393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 28262948 - 28262853
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28262948 |
atgatttgcacacgtgacacataatgactgaactcatttattagataaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
28262853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 38486663 - 38486568
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38486663 |
atgatttgcacacgtggcacatgatgactgaactcatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
38486568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 6589091 - 6589186
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
6589091 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtctctgcaaaata |
6589186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 11767047 - 11767142
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
11767047 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
11767142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 223
Target Start/End: Original strand, 34877903 - 34877994
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
|||||||||||| | | ||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34877903 |
atgatttgcacacgcggcacatgatgattgaacccattttttagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaa |
34877994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 35470150 - 35470055
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35470150 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35470055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 30 - 222
Target Start/End: Original strand, 45228617 - 45228804
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgtctcattttgg |
129 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||||||| |||||||||||| || ||||||||||||||||| | |||||| | |
|
|
| T |
45228617 |
ctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaaattgttgtttttggtccctg-----gctccatttttg |
45228711 |
T |
|
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
| |||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
45228712 |
tgatgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgataaaggtccctgca |
45228804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 2945715 - 2945620
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||| |||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2945715 |
atgatttgcacacgtggcacatgatgaccgaactcatttattagaaaaatagttcctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
2945620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 3808049 - 3807954
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||| || ||||||||||||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
3808049 |
atgatttgcacacgtgacacatgatgaccgaacccatttattagataaatagtccctgcaaaatcttttaatttttaaaaaggtccctacaaaata |
3807954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 6846990 - 6846895
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| || ||| ||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
6846990 |
atgatttgcgcacgtggcacatgatgattgaatccatttattaaaaaaatagtctctgtaaaatcttttgattttgaaaaaggtccctgcaaaata |
6846895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 14543712 - 14543903
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgtctcat-tttg |
128 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| ||||||||| ||||| ||||||||||||||||| ||||| ||| |
|
|
| T |
14543712 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgtaaaaatattt-gttgtttttggtccctg------tctcaactttt |
14543804 |
T |
|
| Q |
129 |
gttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|| |||||||||||| |||||||||||||| |||||||||||||| || |||||||| ||||||||||||||||| | |||||||||| | ||||||| |
|
|
| T |
14543805 |
gtgatgatttgcacacgtgacacatgatgactgaatccatttattagagaaatagtctttgcaaaatcttttgattatgaaaaaggtccctacaaaata |
14543903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 35666005 - 35666100
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| | |||||||||||||| |||| |||||||| |||||||||||| |||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
35666005 |
atgatttgcatacgtgacacatgatgactgaactcatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtccctacaaaata |
35666100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 37527292 - 37527197
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37527292 |
atgatttgcacacgtgacacatgatgcctgaactcatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaagatctctgcaaaata |
37527197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 132 - 222
Target Start/End: Original strand, 30223591 - 30223681
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30223591 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgca |
30223681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 132 - 222
Target Start/End: Complemental strand, 41054046 - 41053956
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
41054046 |
atgatttgcacatgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgagaaaggtccctgca |
41053956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 46759940 - 46759764
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgtctcattttgg |
129 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||| || || ||| | |
|
|
| T |
46759940 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgac----tc-cacttttg |
46759846 |
T |
|
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
| |||||||||||| |||||||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |||| |
|
|
| T |
46759845 |
tgatgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgtttttgaaaa |
46759764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 31503650 - 31503558
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31503650 |
atttgtacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
31503558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 6892024 - 6892119
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| || | ||||| |||| ||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
6892024 |
atgatttgcacaggtggcagaagatgactgaacccatttattagaaaaattgtccctgcaaaatcttttgatatttaaaaaggtccctgcaaaata |
6892119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 28529139 - 28529044
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||| ||||||||||| |||| ||||||||||||||||||||| ||| || |||||| |
|
|
| T |
28529139 |
atgatttgcacacgtgacacataatgactgaatccatttattagaaaaatagtcaatgcacaatcttttgatttttaaaaagatccctgtaaaata |
28529044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 44841485 - 44841580
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||||| |||| ||||||||| ||||||||||||| |||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44841485 |
atgatttggacacgtggcacatgatgactgaacccatttattagaaaaatagtccccgcaaaatcgttagatttttaaaaaggtccttgcaaaata |
44841580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 145 - 227
Target Start/End: Complemental strand, 36684678 - 36684596
Alignment:
| Q |
145 |
gtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
36684678 |
gtgacacatgatgactgaacccatttattagaaaaataatccctgcaaaatcttttgatttttgaaaaggtctctgcaaaata |
36684596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 166 - 227
Target Start/End: Complemental strand, 30760857 - 30760796
Alignment:
| Q |
166 |
catttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30760857 |
catttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgccaaata |
30760796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 8144525 - 8144434
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8144525 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
8144434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 23399745 - 23399836
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
23399745 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
23399836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 25092293 - 25092384
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25092293 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
25092384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 29198436 - 29198527
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
29198436 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
29198527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 44568459 - 44568550
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
44568459 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagataaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
44568550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 5354988 - 5354893
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||| | ||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
5354988 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagttcttgcaaaatcttttgattttgaaaaaggtccctccaaaata |
5354893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 135 - 226
Target Start/End: Complemental strand, 27037800 - 27037710
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27037800 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaat |
27037710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 37159838 - 37159759
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
|||||||||||| ||| || |||||| ||||| ||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37159838 |
atgatttgcacacgtgtcatatgatggttgaacccatttattagaaaaatagttcctgcaaaatcttttgatttttaaaa |
37159759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 38186632 - 38186537
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||| | || ||||||||| |||||||| |||||||||||||||||| || ||||||||| |
|
|
| T |
38186632 |
atgatttgcacacgtgacacatgatgactgaacccattttgtagataaatagtccatgcaaaatattttgatttttaaaaaggcccctgcaaaata |
38186537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 8144656 - 8144548
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
8144656 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
8144557 |
T |
|
| Q |
128 |
ggttatgat |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
8144556 |
ggttttgat |
8144548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 5233810 - 5233913
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| ||||| |||||| |
|
|
| T |
5233810 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtcccatttt |
5233909 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
5233910 |
ggtt |
5233913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 23399614 - 23399717
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
23399614 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
23399713 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
23399714 |
ggtt |
23399717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 25988747 - 25988644
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
25988747 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
25988648 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
25988647 |
ggtt |
25988644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 123 - 227
Target Start/End: Original strand, 12932540 - 12932644
Alignment:
| Q |
123 |
attttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
||||| || ||||||| ||| |||||||||||||| |||| ||| | | |||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12932540 |
atttttgtgatgatttaaacacgtgacacatgatgactgaactcatacactagaaaaatagtccttgcaaaatcttttgatttttgaaaaggtccatgca |
12932639 |
T |
|
| Q |
223 |
aaata |
227 |
Q |
| |
|
||||| |
|
|
| T |
12932640 |
aaata |
12932644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 25988616 - 25988525
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
25988616 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctacaaaata |
25988525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 48852574 - 48852642
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| || |||||||||||||||||| |||| |
|
|
| T |
48852574 |
atgatttgcacatgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatatttt |
48852642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 1614902 - 1614816
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1614902 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
1614816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 3975551 - 3975637
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3975551 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
3975637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 9659687 - 9659601
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9659687 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
9659601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16853587 - 16853501
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16853587 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaa |
16853501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 211
Target Start/End: Original strand, 35104148 - 35104227
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
35104148 |
atgatttgcacacgtggcacatgatggctgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaa |
35104227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 41053844 - 41053930
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41053844 |
ctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
41053930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 3975709 - 3975635
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
3975709 |
atgatttgcacacgtggcacatgatgactgaactcatttattagaaaaatagtccctgtaaaatcttttgatttt |
3975635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 5233955 - 5234032
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||| ||||||||| || |||||||||||||||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
5233955 |
cacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatattttgattttgaaaaaggtccctgcaaaata |
5234032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 6847119 - 6847061
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6847119 |
gactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgtaa |
6847061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 16940892 - 16940966
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
16940892 |
atgatttgcacacgtggcacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgatttt |
16940966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 1614561 - 1614664
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
1614561 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
1614660 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
1614661 |
ggtt |
1614664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 14739002 - 14738949
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14739002 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 25092162 - 25092265
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
25092162 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
25092261 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
25092262 |
ggtt |
25092265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 27458401 - 27458504
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
27458401 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaatatgcctcatttt |
27458500 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
27458501 |
ggtt |
27458504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 41054234 - 41054131
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
41054234 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcctcatttt |
41054135 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
41054134 |
ggtt |
41054131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 227
Target Start/End: Original strand, 1614704 - 1614764
Alignment:
| Q |
167 |
atttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
1614704 |
atttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
1614764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 6079811 - 6079867
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6079811 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
6079867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11767273 - 11767217
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
11767273 |
ctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaa |
11767217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12932781 - 12932725
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12932781 |
ctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
12932725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 117 - 225
Target Start/End: Original strand, 20355530 - 20355638
Alignment:
| Q |
117 |
tgtctcattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
216 |
Q |
| |
|
||||||| ||| || |||||||| ||| ||||||||||||||||||| ||| || | | ||||||||||| | ||||| ||||| |||||||||||||| |
|
|
| T |
20355530 |
tgtctcacttttgtgatgatttgtacacgtgacacatgatgattgaacccaattttgtagaaaatagtccccgtaaaatattttgctttttaaaaaggtc |
20355629 |
T |
|
| Q |
217 |
catgcaaaa |
225 |
Q |
| |
|
| ||||||| |
|
|
| T |
20355630 |
cttgcaaaa |
20355638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 23676135 - 23676237
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcattttg |
23676234 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
23676235 |
gtt |
23676237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 132 - 196
Target Start/End: Complemental strand, 39438899 - 39438835
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||| | || ||||||||| || ||||||||||||||||||| |
|
|
| T |
39438899 |
atgatttgcacatgtgacacatgatgactaaacccatttattagagaaatagtccctgcaaaatc |
39438835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 39833234 - 39833178
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39833234 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
39833178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45228916 - 45228860
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45228916 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45228860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 5354770 - 5354856
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5354770 |
ctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
5354856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 23676450 - 23676364
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
23676450 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
23676364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29198660 - 29198574
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
29198660 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
29198574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 35838054 - 35838149
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| || | ||||||||| || ||||||||| |||| ||| |||||||||| |||||||||| |||||||| |
|
|
| T |
35838054 |
atgatttgcacacgtggcacatgatgactggacccatttattagagaaatagtccttgcagaattttttgattttgaaaaaggtcccggcaaaata |
35838149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 38186369 - 38186424
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaa |
38186424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 44841359 - 44841414
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
44841414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 48192260 - 48192346
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaat |
48192346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 9659485 - 9659559
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
9659485 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgttttt |
9659559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 39520727 - 39520642
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||||| | |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
39520642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 3975836 - 3975734
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||| ||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
3975836 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt-cctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
3975738 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
3975737 |
ggtt |
3975734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 9659357 - 9659460
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
9659357 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaatatgcctcatttt |
9659456 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
9659457 |
ggtt |
9659460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 26878069 - 26878016
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26878069 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 29198305 - 29198408
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
29198305 |
ctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
29198404 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
29198405 |
ggtt |
29198408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 35015218 - 35015165
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35015218 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 35104290 - 35104237
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35104290 |
aaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35104237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 35837926 - 35838029
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| ||||||||||||||||| || |||||||||||| |
|
|
| T |
35837926 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaatttgttgtttttggtccctgtaaatatgtctcatttt |
35838025 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35838026 |
ggtt |
35838029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 44568328 - 44568431
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
44568328 |
ctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
44568427 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
44568428 |
ggtt |
44568431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 48192486 - 48192433
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
48192486 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 1559703 - 1559647
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1559703 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaa |
1559647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 1974011 - 1974067
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
1974011 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
1974067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12894400 - 12894344
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12894400 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12894344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 17999719 - 17999663
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17999719 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
17999663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 19005808 - 19005740
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| | ||| ||||||||||||| |||| |
|
|
| T |
19005808 |
atgatttgcacatgtgacacatgatgattgaacccatttattagtaaataggtccctgcaaaatatttt |
19005740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19757750 - 19757806
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
19757750 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19757806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21554751 - 21554695
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
21554751 |
ctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaa |
21554695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25547488 - 25547432
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25547488 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25547432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 135 - 211
Target Start/End: Original strand, 26877811 - 26877886
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
26877811 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaa |
26877886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28911904 - 28911848
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28911904 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28911848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 127
Target Start/End: Complemental strand, 31503780 - 31503682
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgtaaaagaaatttgttgtttttggtccctgcaaatatgtctcatttt |
31503682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 31732103 - 31732159
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31732103 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaa |
31732159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35838335 - 35838279
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35838335 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35838279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 48852446 - 48852533
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
48852446 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaaattttttttgttgtttttggtccctgcaaat |
48852533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 5234202 - 5234116
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5234202 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
5234116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 8144297 - 8144383
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8144297 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa |
8144383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 16941049 - 16940994
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16940994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 23399974 - 23399888
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
23399974 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
23399888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 23676265 - 23676335
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
23676265 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgatttt |
23676335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 25092546 - 25092460
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25092546 |
ctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
25092460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 25988387 - 25988473
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25988387 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
25988473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 27037595 - 27037681
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
27037595 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
27037681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 28262715 - 28262801
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
28262715 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaa |
28262801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 30223793 - 30223707
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
30223793 |
ctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaa |
30223707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35469882 - 35469968
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
35469882 |
ctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaa |
35469968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 132 - 195
Target Start/End: Original strand, 39520528 - 39520591
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaat |
195 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| |
|
|
| T |
39520528 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaat |
39520591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 46828946 - 46829032
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46828946 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
46829032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 48854068 - 48853982
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48854068 |
ctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
48853982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 28263071 - 28263013
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28263071 |
gactaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgtaa |
28263013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 25 - 83
Target Start/End: Complemental strand, 30352907 - 30352849
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||| ||||||||| ||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30352907 |
gatggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 32189390 - 32189332
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
32189390 |
gactaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
32189332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 1006837 - 1006890
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1006837 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 37 - 86
Target Start/End: Complemental strand, 1271590 - 1271541
Alignment:
| Q |
37 |
atggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1271541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 6108336 - 6108389
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
6108336 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 16940764 - 16940867
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||| |||| ||||||||||||||| |||||||||||||| ||||| ||| |||||||| |
|
|
| T |
16940764 |
ctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaaaaaacaattgttgtttttggtccttgcaaatatgcctcatttt |
16940863 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
16940864 |
ggtt |
16940867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 26877680 - 26877783
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
26877680 |
ctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
26877779 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
26877780 |
ggtt |
26877783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 39439027 - 39438924
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||| |||||||||||| || |||||||||||||||||||| |||||| ||||| |
|
|
| T |
39439027 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtcttatttt |
39438928 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
39438927 |
ggtt |
39438924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 44508722 - 44508775
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
44508722 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 44509052 - 44508999
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
44509052 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 46759660 - 46759744
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgca |
114 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
46759660 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgca |
46759744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 2945843 - 2945787
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2945843 |
ctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
2945787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3807866 - 3807922
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
3807866 |
ctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaa |
3807922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 6509210 - 6509266
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6509210 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaa |
6509266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6509468 - 6509412
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6509468 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
6509412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 7432249 - 7432201
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 8555797 - 8555741
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
8555797 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
8555741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10358366 - 10358310
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10358366 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
10358310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 17999467 - 17999523
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
17999467 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaa |
17999523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 19561448 - 19561392
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
19561448 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19561392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20388276 - 20388332
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
20388276 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20388332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21223407 - 21223463
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
21223407 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
21223463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 28528907 - 28528963
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| | ||||||||||||||| |
|
|
| T |
28528907 |
ctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaa |
28528963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 28911579 - 28911635
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
28911579 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
28911635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35210513 - 35210457
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35210513 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35210457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 37372902 - 37372846
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
37372902 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaa |
37372846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 39832908 - 39832964
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39832908 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39832964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 44344787 - 44344731
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44344787 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44344731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45073639 - 45073583
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45073639 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45073583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 46304382 - 46304326
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
46304382 |
ctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
46304326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 6589271 - 6589216
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgtaa |
6589216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 44568688 - 44568602
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
44568688 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
44568602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 1007227 - 1007177
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||||||||||||| |
|
|
| T |
1007227 |
ctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 1559345 - 1559399
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1559345 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 6589023 - 6589073
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||| |||| |
|
|
| T |
6589023 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 6911245 - 6911199
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| ||||| |
|
|
| T |
6911245 |
ctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 17854149 - 17854207
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
17854149 |
gactaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
17854207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Original strand, 37372441 - 37372495
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
37372495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 131
Target Start/End: Complemental strand, 41054163 - 41054071
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttggtt |
131 |
Q |
| |
|
||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcctcattttggtt |
41054071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 43300614 - 43300664
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
43300614 |
ctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 46304088 - 46304138
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||| ||||||||| |
|
|
| T |
46304088 |
ctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 7431953 - 7432002
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
7431953 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 30223463 - 30223516
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||| |||||||||||| |
|
|
| T |
30223463 |
ctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 39438743 - 39438792
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
39438743 |
ctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 39520400 - 39520503
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| | | |||||||| |||||||| ||||||||||||||| |||||||||||||||| ||| || ||||||||| |
|
|
| T |
39520400 |
ctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctccaaatatatctcatttt |
39520499 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
39520500 |
ggtt |
39520503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 43058751 - 43058808
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||| || |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
43058751 |
actaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaa |
43058808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 21 - 86
Target Start/End: Complemental strand, 46829319 - 46829254
Alignment:
| Q |
21 |
ttaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||| |||||||||||||||| | |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
46829319 |
ttaaaatggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaa |
46829254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 489070 - 489014
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
489070 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaa |
489014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10358003 - 10358059
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| | || || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10358003 |
ctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
10358059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13769776 - 13769832
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
13769776 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
13769832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 13770079 - 13770023
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
13770079 |
ctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgtaa |
13770023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18022702 - 18022646
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
18022702 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18022646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 19561156 - 19561204
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| |
|
|
| T |
19561156 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20388673 - 20388617
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
20388673 |
ctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgtaa |
20388617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 21223746 - 21223694
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
21223746 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 23816672 - 23816728
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
23816672 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgtaa |
23816728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31732449 - 31732393
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
31732449 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaa |
31732393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35470278 - 35470222
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||| |||||||| | ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
35470278 |
ctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
35470222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 37527420 - 37527364
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| | |||||| ||||||||||||||| |
|
|
| T |
37527420 |
ctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaa |
37527364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 39719640 - 39719584
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
39719640 |
ctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaa |
39719584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 41365212 - 41365164
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||| ||||||| |
|
|
| T |
41365212 |
ctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 44402962 - 44403018
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
44402962 |
ctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaa |
44403018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 44958504 - 44958448
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
44958504 |
ctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
44958448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 45073316 - 45073372
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||| || |||||||| ||||| ||||||||| |
|
|
| T |
45073316 |
ctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaa |
45073372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 19465797 - 19465840
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
19465797 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
19465840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||||| ||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 35665879 - 35665934
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||| | ||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
35665879 |
ctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 37952906 - 37952844
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
37952906 |
cacatgatgattgaatccattttatagaaaaa-agtccctgtaaaatattttgttttttaaaaa |
37952844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 217
Target Start/End: Complemental strand, 1271466 - 1271384
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| |||||||| |||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1271466 |
atttgtacacgtggcacatgatgactgaacccatttatcagaaaaatagtcctgacaaatatttttgatttttaaaaaggtcc |
1271384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 6509288 - 6509330
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
6509288 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
6509330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Original strand, 10358183 - 10358225
Alignment:
| Q |
184 |
tccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
10358183 |
tccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
10358225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 13769950 - 13769992
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
13769950 |
gtccctgcaaaatattttgctttttaaaaaggtccttgcaaaa |
13769992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 18926887 - 18926945
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||| | |||||||| |||||||| ||| ||||||||||| |
|
|
| T |
18926887 |
gactaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgtaa |
18926945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 21554573 - 21554531
Alignment:
| Q |
184 |
tccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
21554573 |
tccctgcaaaatattttgtttttaaaaaaggtccatgcaaaat |
21554531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 27458529 - 27458579
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaata |
182 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || ||||| |
|
|
| T |
27458529 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaata |
27458579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 32189078 - 32189124
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
32189078 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 75
Target Start/End: Complemental strand, 37159907 - 37159861
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
37159907 |
actaaaatatgattttggtttctgcaaatatgtttcgttttggtttt |
37159861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 45021496 - 45021550
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgtttt-gattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
45021496 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 6954862 - 6954915
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgta |
6954915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 35104080 - 35104133
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||| ||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
35104080 |
ctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5308325 - 5308381
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5308325 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
5308381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 5308684 - 5308629
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
5308684 |
ctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
5308629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6892258 - 6892202
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| | |||||| |||||||||||||| |
|
|
| T |
6892258 |
ctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaa |
6892202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||| ||||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 19005600 - 19005648
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
19005600 |
ctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19783817 - 19783873
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19783817 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
19783873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 24717530 - 24717478
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| |||||||| ||||||||||| |
|
|
| T |
24717530 |
ctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 31310677 - 31310637
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
31310677 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttg |
31310637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34878123 - 34878067
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||| || |||||| |
|
|
| T |
34878123 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaa |
34878067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 39719355 - 39719411
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| || ||||| |||||||| |||||| |
|
|
| T |
39719355 |
ctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaa |
39719411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 44403247 - 44403195
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||||||||| |
|
|
| T |
44403247 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 45021854 - 45021806
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| ||||||| |
|
|
| T |
45021854 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 46648713 - 46648657
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
46648713 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgtaa |
46648657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 48359073 - 48359025
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| |
|
|
| T |
48359073 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 209)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 13215295 - 13215200
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13215295 |
atgatttgcacatgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaatggtccctgcaaaata |
13215200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 30 - 227
Target Start/End: Original strand, 27109075 - 27109267
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgtctcattttgg |
129 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||| ||||||||||| ||| |||| |||||||||||| | || ||| | |
|
|
| T |
27109075 |
ctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctataaaaaaaaattgttggttttggtccctg-----gctccacttttg |
27109169 |
T |
|
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
| |||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
27109170 |
tgatgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
27109267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 132 - 224
Target Start/End: Original strand, 3832401 - 3832493
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaa |
224 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3832401 |
atgatttgcacacgtgacacatgatgactgaacctatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaa |
3832493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 43672065 - 43672157
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43672065 |
atttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
43672157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 1295417 - 1295322
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1295417 |
atgatttgcacatgtggcacatgatgactgaactcatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtctttgcaaaata |
1295322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 35686211 - 35686116
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35686211 |
atgatttgcacacgtagcacatgatgactgaacccatttattaaaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
35686116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 36815704 - 36815609
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| || |||||||||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
36815704 |
atgatttgcacacgtgacacatgatgactgaatccatttattagagaaatagtccctgcaaaatcttttggttttgaaaaaggtccctgcaaaata |
36815609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 118 - 227
Target Start/End: Original strand, 7121067 - 7121176
Alignment:
| Q |
118 |
gtctcattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||| ||| || |||||||||||| |||||||||||||||| || ||||||||| |||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
7121067 |
gtctcacttttgtgatgatttgcacacgtgacacatgatgattaaacccatttattagaaaaataattcctgcaaaatcttttgatttttaaaaaggtca |
7121166 |
T |
|
| Q |
218 |
atgcaaaata |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
7121167 |
ttgcaaaata |
7121176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 38231564 - 38231641
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaa |
212 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38231564 |
atttgcacatgtggcacatgatgactgaatccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaa |
38231641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 132 - 224
Target Start/End: Original strand, 16523119 - 16523211
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaa |
224 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
16523119 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttaatttttaaaaaggtccctgcaaa |
16523211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 3172296 - 3172391
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| | |||||||| |||| |||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3172296 |
atgatttgcacatgtggcgcatgatgactgaactcatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
3172391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 11788182 - 11788277
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||| | |||| ||| |||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
11788182 |
atgatttgcacatgtgacacatgataactgaacacatctattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggttcctgcaaaata |
11788277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 34964031 - 34963937
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| |||||||||||||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34964031 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaatagtccctacaaaatcttttgattttt-aaaaggtccctgcaaaata |
34963937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 44559279 - 44559184
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || |||||||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
44559279 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtccccgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
44559184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 132 - 226
Target Start/End: Complemental strand, 37910990 - 37910896
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||||||| || ||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37910990 |
atgatttgcacatgtggcatatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaat |
37910896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 13850650 - 13850746
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttg-aaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||| |||||||||||| || ||||||||| |
|
|
| T |
13850650 |
atgatttgcacacgtgacacatgatgattgaacccatttattagaaaaaatagtccctgcaaaatcttttaatttttaaaaagttcactgcaaaata |
13850746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 31909349 - 31909270
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31909349 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaatagtccctgcaaaatgttttgatttttaaaa |
31909270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 146459 - 146550
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
146459 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
146550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 1138112 - 1138208
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaa-atagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1138112 |
atgatttgcacacgtggcacatgatgactgaactcatttattaaaaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
1138208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 25705316 - 25705225
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25705316 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
25705225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 20939195 - 20939100
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| ||| |||||||||| |||| ||||||||| |||||||||||||||||||||| |||||||||||||||| ||| || |||||| |
|
|
| T |
20939195 |
atgatttacacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcgtttgatttttaaaaagatccttgtaaaata |
20939100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 35155422 - 35155517
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||| | |||||||||| |||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
35155422 |
atgatttgcacatgtgccacatgatgactgaactcattttgtagaaaaatagttcctgcaaaatattttgatttttaaaaaggtccctgcaaaata |
35155517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 30215424 - 30215527
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
30215424 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
30215523 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
30215524 |
ggtt |
30215527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 15842594 - 15842685
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15842594 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
15842685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 16673544 - 16673635
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
16673544 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
16673635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 20131450 - 20131541
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20131450 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
20131541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 29859620 - 29859711
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
29859620 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
29859711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 30215639 - 30215730
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
30215639 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
30215730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 41451970 - 41452061
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
41451970 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
41452061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 28 - 131
Target Start/End: Original strand, 146326 - 146431
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatt |
125 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
146326 |
gactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcatt |
146425 |
T |
|
| Q |
126 |
ttggtt |
131 |
Q |
| |
|
|||||| |
|
|
| T |
146426 |
ttggtt |
146431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 211
Target Start/End: Original strand, 10671760 - 10671839
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaa |
211 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
10671760 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgtttttgaaaa |
10671839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 4424025 - 4424099
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
4424025 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgatttt |
4424099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 25 - 131
Target Start/End: Complemental strand, 5335043 - 5334935
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctc |
122 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
5335043 |
gatggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctc |
5334944 |
T |
|
| Q |
123 |
attttggtt |
131 |
Q |
| |
|
||||||||| |
|
|
| T |
5334943 |
attttggtt |
5334935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 23732199 - 23732125
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
23732199 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgatttt |
23732125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 153 - 227
Target Start/End: Original strand, 29831940 - 29832014
Alignment:
| Q |
153 |
tgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||| ||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
29831940 |
tgatgattgaacctatttattagaaaaatagtctctgcaaaatcttttgatttttaaaaagatccctgcaaaata |
29832014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 4423897 - 4424000
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
4423897 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
4423996 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
4423997 |
ggtt |
4424000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 14003411 - 14003510
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
14003411 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
14003510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 25705447 - 25705344
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
25705447 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
25705348 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
25705347 |
ggtt |
25705344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 5164148 - 5164088
Alignment:
| Q |
167 |
atttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5164148 |
atttattagaaaaattgtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
5164088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 15842464 - 15842566
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcattttg |
15842563 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
15842564 |
gtt |
15842566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 29859490 - 29859592
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
29859589 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
29859590 |
gtt |
29859592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 34317928 - 34317996
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
34317928 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaatagtccctgcaaaatatttt |
34317996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 146688 - 146602
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
146688 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
146602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 2481555 - 2481469
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2481555 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
2481469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 13850881 - 13850826
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgtaa |
13850826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 18113219 - 18113314
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| || |||||||||| |||| ||||||||| || |||||||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
18113219 |
atgatttacacacgtagcacatgatgagtgaacccatttattagagaaatagtccctgcaaaatcttttgatttaaaaaaaggcccctgcaaaata |
18113314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29859870 - 29859784
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29859870 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaa |
29859784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 30 - 136
Target Start/End: Complemental strand, 44559407 - 44559299
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaattcttttgttgtttttggtccctgcaaatatgtctcatttt |
44559308 |
T |
|
| Q |
128 |
ggttatgat |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
44559307 |
ggttttgat |
44559299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 16522980 - 16523049
Alignment:
| Q |
17 |
aatattaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| | | |||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16522980 |
aatattaataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 18113091 - 18113194
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
18113091 |
ctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
18113190 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
18113191 |
ggtt |
18113194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 20131319 - 20131422
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
20131319 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
20131418 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
20131419 |
ggtt |
20131422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 24358943 - 24358840
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
24358943 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
24358844 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
24358843 |
ggtt |
24358840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 34317800 - 34317903
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
34317800 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcctcatttt |
34317899 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
34317900 |
ggtt |
34317903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 37911118 - 37911015
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||| |||||||||||||| ||||| ||| |||||||| |
|
|
| T |
37911118 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaaatttttttgttgtttttggtccatgcaaatatgcctcatttt |
37911019 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
37911018 |
ggtt |
37911015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 40124968 - 40125071
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||| ||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
40124968 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaatatgtctcatttt |
40125067 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
40125068 |
ggtt |
40125071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 42695870 - 42695973
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
42695870 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattcttttttgttgtttttggtccctgcaaatatgtctcatttt |
42695969 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
42695970 |
ggtt |
42695973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 43789190 - 43789137
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43789190 |
ctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 2481326 - 2481417
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||| |||||||| || ||||||||| ||||||||| |
|
|
| T |
2481326 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaagcttttgatgttgtaaaaggtccctgcaaaata |
2481417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3838262 - 3838206
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3838262 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
3838206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 16523323 - 16523267
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
16523323 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 17302141 - 17302085
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17302141 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
17302085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 43597156 - 43597212
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
43597156 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
43597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 1295544 - 1295489
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgtaa |
1295489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 4794260 - 4794355
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| ||| |||||||||| |||| ||||||||| || ||| |||||||||||| |||||||||||| ||||| |||| || |||||| |
|
|
| T |
4794260 |
atgatttacacacgtggcacatgatgactgaacccatttattagagaaaaagtccctgcaaattcttttgattttgaaaaatgtccctgtaaaata |
4794355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 206
Target Start/End: Original strand, 4842866 - 4843035
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaatgtctcattttgg |
129 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| ||||||||||| ||| ||||||||||||||||| || || ||| | |
|
|
| T |
4842866 |
ctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccctataaaaaaatt--gttgtttttggtccctgac----tc-cacttttg |
4842958 |
T |
|
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
| ||||||| |||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
4842959 |
tgatgattttcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgttttt |
4843035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 5334753 - 5334839
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5334753 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
5334839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 13215062 - 13215148
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13215062 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
13215148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 14003740 - 14003654
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
14003740 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaa |
14003654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 15842821 - 15842735
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15842821 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
15842735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 20131679 - 20131593
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
20131679 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
20131593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 24358618 - 24358704
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
24358618 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa |
24358704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 25705087 - 25705173
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25705087 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
25705173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 1137981 - 1138039
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
1137981 |
gactaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
1138039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 135 - 217
Target Start/End: Complemental strand, 33576013 - 33575932
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
33576013 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccttgcaaaatcttttgattttgaaaaaggtcc |
33575932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 40125096 - 40125170
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||| | ||||||||||||||||||||| |
|
|
| T |
40125096 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaataattcctgcaaaatcttttgatttt |
40125170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 44985621 - 44985679
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44985621 |
gactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44985679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 2481195 - 2481298
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
2481195 |
ctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
2481294 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
2481295 |
ggtt |
2481298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 16673413 - 16673516
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
16673413 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgcaagaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
16673512 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
16673513 |
ggtt |
16673516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 23732326 - 23732224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
23732326 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttg-gtttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
23732228 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
23732227 |
ggtt |
23732224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 41451839 - 41451942
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||| ||||||||| |||||||||||| |
|
|
| T |
41451839 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttgatccctgcaaatatgtctcatttt |
41451938 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
41451939 |
ggtt |
41451942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 44073805 - 44073752
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44073805 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 1497612 - 1497668
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1497612 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
1497668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4424183 - 4424127
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4424183 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4424127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18113452 - 18113396
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
18113452 |
ctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaa |
18113396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20939323 - 20939267
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
20939323 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
20939267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 135 - 215
Target Start/End: Complemental strand, 24358812 - 24358733
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
||||||||| ||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24358812 |
atttgcacacgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggt |
24358733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 24483889 - 24483833
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24483889 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24483833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29865509 - 29865453
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29865509 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaa |
29865453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 33732864 - 33732920
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33732864 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33732920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34318081 - 34318025
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
34318081 |
ctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaa |
34318025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 41693676 - 41693732
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41693676 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
41693732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 42695998 - 42696066
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| |||||||||| || |||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
42695998 |
atgatttgcacacgtgacacatgtagactgaacccatttattagaaaaatagtccctgcaaaatatttt |
42696066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 44559064 - 44559120
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44559064 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44559120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 206
Target Start/End: Complemental strand, 5334907 - 5334837
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
5334907 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgatttt |
5334837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16673769 - 16673683
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16673769 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
16673683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 25750836 - 25750741
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| ||||||| ||| | ||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
25750836 |
atgatttgcacacgtggcacatgatgactgaactcatttattagaaaaatgacccccgtaaaatctttagatttttaaaaaagtccctgcaaaata |
25750741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 25954423 - 25954368
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
25954368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 26238816 - 26238871
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
26238871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 30215555 - 30215625
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
30215555 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgatttt |
30215625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 32476097 - 32476183
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32476097 |
ctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
32476183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 42358702 - 42358757
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
42358757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 3671005 - 3671059
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
3671005 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 36806892 - 36806838
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36806838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 4794132 - 4794235
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
4794132 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
4794231 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
4794232 |
ggtt |
4794235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 16900204 - 16900151
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
16900204 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 16993595 - 16993542
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
16993595 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 19184149 - 19184096
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19184149 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 25299746 - 25299803
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
25299746 |
actaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaa |
25299803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 26239158 - 26239105
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26239158 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 26814227 - 26814174
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26814227 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 31909476 - 31909374
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||||||| |||||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
31909476 |
ctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgtctaatttt |
31909378 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
31909377 |
ggtt |
31909374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 33576115 - 33576062
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
33576115 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 37271741 - 37271794
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37271741 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 37272100 - 37272047
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37272100 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 38980251 - 38980198
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
38980251 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 8046331 - 8046387
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8046331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
8046387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 8046646 - 8046590
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8046646 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
8046590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 9195204 - 9195148
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9195204 |
ctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaa |
9195148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10374776 - 10374832
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
10374776 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10374832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10664986 - 10665042
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10664986 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaa |
10665042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10671632 - 10671688
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10671632 |
ctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
10671688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11713487 - 11713543
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11713487 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11713543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11713843 - 11713787
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| |||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11713843 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11713787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11788414 - 11788358
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11788414 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11788358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22881615 - 22881671
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
22881615 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22881671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26707875 - 26707931
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
26707875 |
ctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaa |
26707931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29865223 - 29865279
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29865223 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29865279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 31225717 - 31225773
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
31225717 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaa |
31225773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 31644843 - 31644899
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
31644843 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
31644899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 32691315 - 32691371
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
32691315 |
ctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaa |
32691371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 36622252 - 36622308
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36622252 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36622308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 36815833 - 36815746
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36815833 |
ctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaat |
36815746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 37228735 - 37228791
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
37228735 |
ctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgtaa |
37228791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 38731831 - 38731887
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38731831 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38731887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 40302337 - 40302281
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40302337 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaa |
40302281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 41694001 - 41693945
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
41694001 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
41693945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 41791310 - 41791254
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
41791310 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgtaa |
41791254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 42696201 - 42696145
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
42696201 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaa |
42696145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 43592048 - 43592104
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
43592048 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
43592104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 43671936 - 43671992
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
43671936 |
ctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgtaa |
43671992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 43672316 - 43672260
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
43672316 |
ctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaa |
43672260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 1138357 - 1138271
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1138357 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaa |
1138271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 33 - 84
Target Start/End: Complemental strand, 3671187 - 3671136
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 4042612 - 4042697
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4042612 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt-cctgtaaattttttttgttgtttttggtccctgcaaa |
4042697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 33575754 - 33575840
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33575754 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
33575840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 35155617 - 35155562
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
35155617 |
ctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 38231818 - 38231763
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| | ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
38231818 |
taaaatatgattttgatccctccaaatatgcttcgttttgattttagtccatgtaa |
38231763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 40125287 - 40125201
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40125287 |
ctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
40125201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 36622584 - 36622534
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||||||| ||||||| |
|
|
| T |
36622584 |
gactaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 43788860 - 43788910
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| |
|
|
| T |
43788860 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 5790560 - 5790613
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||| || || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
5790560 |
ctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 5790897 - 5790844
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
5790897 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 17541384 - 17541437
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || || |||||||||| |||||||| |||||||||||| |
|
|
| T |
17541384 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 19183784 - 19183837
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
19183784 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 26813868 - 26813921
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
26813868 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 41 - 86
Target Start/End: Original strand, 35685986 - 35686031
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35685986 |
ttttggttcctgcaaatatggttcgttttagttttagtccctgtaa |
35686031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 41791019 - 41791076
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| || |||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
41791019 |
actaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
41791076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3172022 - 3172078
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
3172022 |
ctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
3172078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3172530 - 3172474
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3172530 |
ctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaa |
3172474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10375067 - 10375011
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
10375067 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaa |
10375011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10671939 - 10671883
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
10671939 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
10671883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12835327 - 12835383
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
12835327 |
ctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
12835383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20658063 - 20658119
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||| |||||||| || ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
20658063 |
ctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20658119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 24483402 - 24483458
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| ||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24483402 |
ctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24483458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 25300042 - 25299991
Alignment:
| Q |
26 |
atgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| ||||| ||||||| |
|
|
| T |
25300042 |
atgactaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25954117 - 25954173
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25954117 |
ctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaa |
25954173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27310878 - 27310933
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27310878 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg-gtttagtccctgtaa |
27310933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 27311067 - 27311015
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||| |
|
|
| T |
27311067 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30215869 - 30215813
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
30215869 |
ctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaa |
30215813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31226075 - 31226019
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
31226075 |
ctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaa |
31226019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 31325922 - 31325978
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| | || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31325922 |
ctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaa |
31325978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 33733239 - 33733187
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||| |
|
|
| T |
33733239 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34964157 - 34964101
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
34964157 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaa |
34964101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 38231433 - 38231489
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||| | ||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
38231433 |
ctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaa |
38231489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40301977 - 40302033
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
40301977 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaa |
40302033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 44985982 - 44985926
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44985982 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
44985926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 9195056 - 9195111
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
9195056 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 12414021 - 12413978
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
12414021 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
12413978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 12426081 - 12426038
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
12426081 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
12426038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 14003542 - 14003612
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
14003542 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatattttgttttt |
14003612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 16968555 - 16968610
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| | |||||| ||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaa |
16968610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 23732041 - 23732127
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| |||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
23732041 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaa |
23732127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 216
Target Start/End: Complemental strand, 29079874 - 29079835
Alignment:
| Q |
177 |
aaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
216 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29079874 |
aaaatagtccctgtaaaatattttgatttttaaaaaggtc |
29079835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 32691491 - 32691534
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
32691491 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
32691534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 34963797 - 34963852
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||| | ||||| |||||| || ||||||||||||||| ||||| |
|
|
| T |
34963797 |
ctaaaatatggttttgatccctgctaatatgttttgttttgattttagtctctgta |
34963852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 78
Target Start/End: Complemental strand, 35686335 - 35686288
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||| ||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 78
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 43592224 - 43592267
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
43592224 |
gtccctgcaaaatattttggtttttaaaaaggtccctgcaaaat |
43592267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 1497944 - 1497890
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||| | | ||||||||||| |||||||| |||||||||||| |
|
|
| T |
1497944 |
actaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 4042888 - 4042838
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||||||| ||||||||| |
|
|
| T |
4042888 |
ctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 7814735 - 7814681
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
7814735 |
ctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 4794468 - 4794415
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||| |||||||| |||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaa |
4794415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 7814248 - 7814301
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||| ||||| || |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
7814248 |
ctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 23989840 - 23989889
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
23989840 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 227
Target Start/End: Original strand, 37228867 - 37228904
Alignment:
| Q |
190 |
caaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
37228867 |
caaaattttttgatttttaaaaaggtccctgcaaaata |
37228904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 38639414 - 38639463
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |
|
|
| T |
38639414 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 2265395 - 2265339
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2265395 |
ctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
2265339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3837935 - 3837991
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3837935 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgtaa |
3837991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 4731867 - 4731827
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
4731867 |
gtccctgcaaaatattttgttttttaaaaaggtccttgcaa |
4731827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10665292 - 10665236
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
10665292 |
ctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaa |
10665236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 212
Target Start/End: Original strand, 25299896 - 25299947
Alignment:
| Q |
160 |
tgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaa |
212 |
Q |
| |
|
|||||||||||||| || || |||||| ||||||||||||||||||| ||||| |
|
|
| T |
25299896 |
tgaatccatttattagagaagtagtcc-tgcaaaatcttttgattttgaaaaa |
25299947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31326250 - 31326194
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || | ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31326250 |
ctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaa |
31326194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 37910758 - 37910814
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | | ||||||||||| || |||| ||||||||||||||| |
|
|
| T |
37910758 |
ctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaa |
37910814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40786462 - 40786518
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
40786462 |
ctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaa |
40786518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 43597497 - 43597441
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
43597497 |
ctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
43597441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 43710558 - 43710602
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||||||||| |
|
|
| T |
43710558 |
gtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaata |
43710602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 43710706 - 43710650
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| | | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
43710706 |
ctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaa |
43710650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 250)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 12322735 - 12322830
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12322735 |
atgatttgcacatgtggcacatgataattgaaccaatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
12322830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 28507245 - 28507340
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28507245 |
atgatttgcacatgtgacacatgatgactgaactcatttatgagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
28507340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 24977909 - 24978004
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
24977909 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgattttgaaaaaggtccttgcaaaata |
24978004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 12360733 - 12360828
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
12360733 |
atgatttgcacatgtggcacataatgagtgaacccatttattaaaaaaatagtccctgcaaaatcttttgatttgtaaaaaggtccctgcaaaata |
12360828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 15058548 - 15058643
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||| |||| |||| || |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15058548 |
atgatttgcacacgtaacacataatgactgaacccgtttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccttgcaaaata |
15058643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 33045486 - 33045581
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
33045486 |
atgatttgcacacgtggcacatgatgagtgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
33045581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 33234677 - 33234772
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||| |||||| |||| |||| |||| |
|
|
| T |
33234677 |
atgatttgcacatgtggcacatgatgagtgaacccatttattagaaaaatagtccctgcaaaatcttttgatttgtaaaaacgtccctgcataata |
33234772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 46183819 - 46183914
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
46183819 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
46183914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 17129954 - 17129859
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| || ||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
17129954 |
atgatttgcacacgtggcagatgatgactgaacccatttattaaaaaaatagtccctgcaaaatcttttgatttttaaaatggtccttgcaaaata |
17129859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 24510072 - 24510167
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| ||||| |||||||||| |||| | ||||||| |||||||||||| |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
24510072 |
atgatttgcagatgtggcacatgatgactgaacctatttattagaaaaatagtccatgcaaaatcttttgatttttaaaaagatccctgcaaaata |
24510167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 39747603 - 39747698
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
39747603 |
atgatttgcacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
39747698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 51986446 - 51986363
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| ||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
51986446 |
atgatttgcacacgtgacacatgatgactgaatccatttattaaaaaaataatccttgcaaaatcttttgatttttaaaaaggt |
51986363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 49073923 - 49073831
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49073923 |
atgatttgcacacgtgtcacatgac---tgaatccatttattagaaaaatagtccatgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
49073831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 3247429 - 3247338
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
3247429 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
3247338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 129 - 227
Target Start/End: Complemental strand, 15211729 - 15211634
Alignment:
| Q |
129 |
gttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||| |||||||||| | || |||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15211729 |
gttatgatttgcacatg---cacatgatgactaaactcatttattagaaaaatagtccctacaaaatcttttgatttttaaaaaggtccctgcaaaata |
15211634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 7350606 - 7350512
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| | ||| |||||||||| | || ||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7350606 |
atgatttgca-acgtggcacatgatgactaaacccatttattagaaaaataatccctgcaaaatcttttgatttttaaaaaggtccttgcaaaata |
7350512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 10887363 - 10887458
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
10887363 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttaattttgaaaaaggtctctgcaaaata |
10887458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 15466262 - 15466357
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||| ||||||||| ||||||||||||||||||||| |||||||||| |||||| ||| ||||||||| |
|
|
| T |
15466262 |
atgatttgcacacgtggcacatgatgtctgaacccatttattagaaaaatagtccctgcaaaattttttgattttcaaaaagatccctgcaaaata |
15466357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 223
Target Start/End: Original strand, 31404547 - 31404638
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
|||||| ||||| | | |||||||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31404547 |
atgattagcacacgcggcacatgatgagtgaacccatttattagaaaagtagtccctgcaaaatcttttgatttttaaaaaggtccctgcaa |
31404638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 41738926 - 41739021
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| | ||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
41738926 |
atgatttgcacacgtggcacatgatgactgaacctatttattagaaaaatagtccctgcaaaatcttttgattttggaaaaggtctctgcaaaata |
41739021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 42483201 - 42483107
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42483201 |
atgatttgcacacgtgtcacatgatgactgaa-ccatttattagaaaagtagtcccgacaaaatcttttgatttttaaaaaggtccctgcaaaata |
42483107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 21 - 131
Target Start/End: Original strand, 46183677 - 46183789
Alignment:
| Q |
21 |
ttaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atg |
118 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||| ||| |
|
|
| T |
46183677 |
ttaagttgactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaaaaaaaaattgttgtttttggtccctgcaaatatg |
46183776 |
T |
|
| Q |
119 |
tctcattttggtt |
131 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46183777 |
cctcattttggtt |
46183789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 45638582 - 45638685
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
45638582 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
45638681 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
45638682 |
ggtt |
45638685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 8140665 - 8140574
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
8140665 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
8140574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 10631395 - 10631304
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
10631395 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtctctgcaaaata |
10631304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 15516715 - 15516806
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15516715 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
15516806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 16026805 - 16026714
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
16026805 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
16026714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 24654033 - 24653942
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
24654033 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
24653942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 31061018 - 31060927
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31061018 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccttgcaaaata |
31060927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 33000536 - 33000445
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33000536 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
33000445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 38150981 - 38151072
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
38150981 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
38151072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 38164064 - 38164155
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38164064 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
38164155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 40718341 - 40718250
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
40718341 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
40718250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 45380405 - 45380496
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
45380405 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
45380496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 45638713 - 45638804
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
45638713 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
45638804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 47819365 - 47819456
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
47819365 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
47819456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 4789438 - 4789533
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| ||| ||| |||||||||| |||| ||||||||| ||||||| ||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
4789438 |
atgatttaaacacgtggcacatgatgactgaacccatttattagaaaaatggtccctgcaaaatcttttgatttttgaaaaggtctctgcaaaata |
4789533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 8364846 - 8364751
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| ||||||||||||| |||||||||||||||||||||||| || | ||||||| |
|
|
| T |
8364846 |
atgatttgcacacgtgacacatgatgactgaactcatttattaaaaaaatagtccctataaaatcttttgatttttaaaaagggccctacaaaata |
8364751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 19198819 - 19198724
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||| | ||| ||||||||| |||||||||| |||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
19198819 |
atgatttgcacacgtggcacatgataacggaacccatttattaaaaaaatagtctctgcaaaatcttttgaattttaaaaaggtccctgcaaaata |
19198724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 26324817 - 26324722
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || ||||| |||| ||| | ||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26324817 |
atgatttgcacacatgtcacataatgactgagcctatttattagaaaaatagcccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
26324722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 26699420 - 26699514
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| | || ||||||||||||||||||| |||| | || ||||||||||||| ||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
26699420 |
atgatttacgcacgtgacacatgatgattgaacccatat-ttagaaaaatagtccccgcaaaatattttgatttttaaaaaggtccttgcaaaata |
26699514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 33000307 - 33000393
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33000307 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
33000393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 44157912 - 44157817
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| | |||||||||||||||||| ||||| |||| |||||||||| ||||||||| |
|
|
| T |
44157912 |
atgatttgcacacgtggcacatgatgagtgaacccatttattaaagaaatagtccctgcaaaatattttgtttttgaaaaaggtccctgcaaaata |
44157817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 48730488 - 48730393
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| | |||| | ||||||||||||| ||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
48730488 |
atgatttgcacacgtgacacatgatgactgaacctattttgtagaaaaatagtcccagcaaaatattttaatttttaaaatggtccatgcaaaata |
48730393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 16060725 - 16060799
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
16060725 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgatttt |
16060799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 40718472 - 40718369
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | ||||||||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
40718472 |
ctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
40718373 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
40718372 |
ggtt |
40718369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 47819234 - 47819337
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
47819234 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
47819333 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
47819334 |
ggtt |
47819337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 3247559 - 3247457
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcattttg |
3247460 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
3247459 |
gtt |
3247457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 24507612 - 24507703
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
24507612 |
atttgcacacgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
24507703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 30323160 - 30323069
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
30323160 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctacaaaata |
30323069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 32035665 - 32035567
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttga---aaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||| ||||||||| || |||| || || |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32035665 |
atgatttgtacacgtgacacatgatgactgaacccatttattagagaaaaaaaagcccatgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
32035567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 35056761 - 35056670
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
35056761 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctacaaaata |
35056670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 38163934 - 38164036
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
38164033 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
38164034 |
gtt |
38164036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 8140797 - 8140693
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa---atgtctcattt |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
8140797 |
ctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatgtctcattt |
8140698 |
T |
|
| Q |
127 |
tggtt |
131 |
Q |
| |
|
||||| |
|
|
| T |
8140697 |
tggtt |
8140693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 18927907 - 18928002
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| ||| |||||||||| |||| | ||||||| ||||||||||| ||| ||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
18927907 |
atgatttacacacgtggcacatgatgactgaaccaatttattagaaaaatagtcactgtaaaatcttttgatttttgaaaaggtccctacaaaata |
18928002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 24507841 - 24507755
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24507841 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaa |
24507755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 37624816 - 37624911
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||| |||| ||||||||||| | || |||||||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
37624816 |
atgatttgcacacgtggcacatcatgaatgaatccattttgtagagaaatagtccctgcaaaatattttaatttttaaaaaggtctctgcaaaata |
37624911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 38151210 - 38151124
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38151210 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
38151124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 25658172 - 25658099
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
25658172 |
atgatttgcaca-gtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgatttt |
25658099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 134 - 227
Target Start/End: Original strand, 34002707 - 34002801
Alignment:
| Q |
134 |
gatttgcacatgtgacacatgatgattgaatccatttatttgaaaa-atagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| ||| |||||||||| ||| | ||||||| |||| ||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34002707 |
gatttgcacacgtggcacatgatgactgagccaatttattaaaaaaaatagtccttgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
34002801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 10887235 - 10887338
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
10887235 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
10887334 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
10887335 |
ggtt |
10887338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 16026936 - 16026833
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
16026936 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaatttttttttgttgtttttggtccctgcaaatatgtctcatttt |
16026837 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
16026836 |
ggtt |
16026833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 17129690 - 17129747
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
17129690 |
actaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaa |
17129747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 132 - 209
Target Start/End: Original strand, 18079529 - 18079606
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaa |
209 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18079529 |
atgatttgcacacgtggcacatgatgactgaacccattttgtagaaaaatagtccctgcaaaatattttgatttttaa |
18079606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 24507481 - 24507584
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
24507481 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
24507580 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
24507581 |
ggtt |
24507584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 30323291 - 30323188
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
30323291 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
30323192 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
30323191 |
ggtt |
30323188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 33000667 - 33000564
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
33000667 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
33000568 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
33000567 |
ggtt |
33000564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 35056892 - 35056789
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
35056892 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
35056793 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35056792 |
ggtt |
35056789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 38136979 - 38136876
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
38136979 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
38136880 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
38136879 |
ggtt |
38136876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 45380274 - 45380377
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
45380274 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatttt |
45380373 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
45380374 |
ggtt |
45380377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 19720941 - 19720850
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| || |||||| || ||||||||| ||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
19720941 |
atttgcacacgtggcacatgatgactgaagcc-tttattagagaaatagtccttgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
19720850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 19721071 - 19720969
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcattttg |
19720972 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
19720971 |
gtt |
19720969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 155 - 227
Target Start/End: Original strand, 32420245 - 32420317
Alignment:
| Q |
155 |
atgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||| |||| ||||||||| |||||||||| |||| ||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
32420245 |
atgactgaacccatttattagaaaaatagttcctgtaaaatctttggatttttaaaaaggtccctgcaaaata |
32420317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 33045688 - 33045632
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33045688 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33045632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 33234910 - 33234854
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33234910 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33234854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 38150851 - 38150953
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtctcattttg |
38150950 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
38150951 |
gtt |
38150953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 44157697 - 44157753
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44157697 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44157753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52254477 - 52254421
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52254477 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
52254421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 3247200 - 3247286
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3247200 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
3247286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 5058989 - 5058934
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaa |
5058934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 8140436 - 8140522
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8140436 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
8140522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 12360966 - 12360880
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12360966 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
12360880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 18208813 - 18208908
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| || | ||||| |||| |||| | || ||||||||||||||||||||| |||||||||||||||| |||| | ||||||| |
|
|
| T |
18208813 |
atgatttgcacacgtggcagaggatgactgaacccatattttagaaaaatagtccctgcaaaatattttgatttttaaaaaagtcccttcaaaata |
18208908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 19720714 - 19720800
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19720714 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19720800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 24653804 - 24653890
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
24653804 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
24653890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 38164293 - 38164207
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
38164293 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
38164207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 47819594 - 47819508
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
47819594 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
47819508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 49923816 - 49923761
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49923816 |
ctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 4789308 - 4789366
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4789308 |
gactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4789366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 10631526 - 10631423
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||| |||||| |||||||||||| |
|
|
| T |
10631526 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtctctgcaaatatgtctcatttt |
10631427 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
10631426 |
ggtt |
10631423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 24654165 - 24654062
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| ||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
24654165 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
24654066 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
24654065 |
ggtt |
24654062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 35005446 - 35005499
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35005446 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3753215 - 3753271
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3753215 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3753271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 4323830 - 4323886
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4323830 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaa |
4323886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 10631166 - 10631222
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
10631166 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10631222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12322606 - 12322662
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
12322606 |
ctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaa |
12322662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13770491 - 13770547
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13770491 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13770547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 16060883 - 16060827
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
16060883 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16060827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18302385 - 18302329
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
18302385 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
18302329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 167 - 227
Target Start/End: Complemental strand, 20948936 - 20948876
Alignment:
| Q |
167 |
atttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| || |||||||| |||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20948936 |
atttattagagaaatagtctctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
20948876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22919686 - 22919742
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
22919686 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
22919742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26191361 - 26191417
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26191361 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
26191417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26324587 - 26324643
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26324587 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
26324643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27521578 - 27521634
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27521578 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
27521634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29072499 - 29072555
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29072499 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29072555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 33234548 - 33234604
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
33234548 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
33234604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35308109 - 35308053
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35308109 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35308053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 39025179 - 39025247
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
39025179 |
atgatttgcactcgtgacacatgatgaccgaacccatttattagaaaaatagtccctgcaaaatatttt |
39025247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 39747833 - 39747777
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39747833 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39747777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 45368492 - 45368548
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45368492 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45368548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 10887596 - 10887510
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10887596 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaa |
10887510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 15526360 - 15526274
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15526360 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa |
15526274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 30322931 - 30323017
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30322931 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa |
30323017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35056532 - 35056618
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35056532 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
35056618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 206
Target Start/End: Complemental strand, 38136848 - 38136778
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
38136848 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgatttt |
38136778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 40718112 - 40718198
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40718112 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
40718198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 45380634 - 45380548
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
45380634 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
45380548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 1810929 - 1810983
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
1810929 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 3679984 - 3679930
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3679984 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 8364619 - 8364704
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaa |
8364704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 181 - 227
Target Start/End: Original strand, 15526174 - 15526220
Alignment:
| Q |
181 |
tagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15526174 |
tagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
15526220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 24977780 - 24977884
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg-taannnnnnnnngttgtttttggtccctgcaa--atgtctcattt |
126 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
24977780 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattt |
24977879 |
T |
|
| Q |
127 |
tggtt |
131 |
Q |
| |
|
||||| |
|
|
| T |
24977880 |
tggtt |
24977884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 25658301 - 25658243
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25658301 |
gactaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
25658243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 26207278 - 26207336
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26207278 |
gactaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
26207336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 990377 - 990324
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
990377 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 7001895 - 7001842
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
7001895 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 15516584 - 15516637
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
15516584 |
ctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 18473274 - 18473327
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
18473274 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 26061958 - 26062011
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26061958 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 31061149 - 31061046
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
31061149 |
ctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatttt |
31061050 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
31061049 |
ggtt |
31061046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 32729047 - 32728994
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
32729047 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 49 - 86
Target Start/End: Original strand, 37646763 - 37646800
Alignment:
| Q |
49 |
cctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37646763 |
cctgcaaatatgcttcgttttgattttagtccctgtaa |
37646800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 41358371 - 41358424
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
41358371 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 44158040 - 44157937
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||||| ||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
44158040 |
ctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccctataaaaaaaatttgttgtttttggtccctgcaaatatgcctcatttt |
44157941 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
44157940 |
ggtt |
44157937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3679628 - 3679684
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3679628 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
3679684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4565334 - 4565278
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4565334 |
ctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaa |
4565278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 6567494 - 6567438
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
6567494 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6567438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11822006 - 11822062
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
11822006 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
11822062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11822363 - 11822307
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11822363 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaa |
11822307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12322968 - 12322912
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
12322968 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
12322912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12361013 - 12361069
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
12361013 |
ctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaa |
12361069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14007491 - 14007547
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14007491 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14007547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 15058420 - 15058476
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
15058420 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaa |
15058476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 16060598 - 16060684
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||| |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
16060598 |
ctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaaattttttttgttgtttttggtccctgcaaat |
16060684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 18473593 - 18473541
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
18473593 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26442897 - 26442841
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26442897 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaa |
26442841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26699604 - 26699549
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
26699604 |
ctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagtctctgtaa |
26699549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29072860 - 29072804
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
29072860 |
ctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaa |
29072804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 32454292 - 32454236
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32454292 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaa |
32454236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 33045357 - 33045413
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
33045357 |
ctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
33045413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 33379890 - 33379942
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33379890 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 35307717 - 35307773
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
35307717 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
35307773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 41738798 - 41738854
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
41738798 |
ctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaa |
41738854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 44641080 - 44641132
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
44641080 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 44641430 - 44641374
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44641430 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44641374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 48956064 - 48956008
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
48956064 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
48956008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 50429207 - 50429151
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
50429207 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50429151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 50799132 - 50799188
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
50799132 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
50799188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 7350733 - 7350647
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||| | |||||||| ||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaatatttttttgttgtttttggtccctgcaaat |
7350647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 15211513 - 15211599
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
15211513 |
ctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaa |
15211599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 18900130 - 18900075
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
18900075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 31060789 - 31060875
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31060789 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
31060875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 134 - 193
Target Start/End: Complemental strand, 49923695 - 49923636
Alignment:
| Q |
134 |
gatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaa |
193 |
Q |
| |
|
||||||||||||| |||||||||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
49923695 |
gatttgcacatgtagcacatgatgactgaacctatttattagaaaaatagtccctgcaaa |
49923636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 3753570 - 3753516
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
3753570 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 21391098 - 21391152
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21391098 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 24649656 - 24649602
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24649602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 29579320 - 29579378
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| || |||| |||||||||||||||| |
|
|
| T |
29579320 |
gactaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaa |
29579378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 35005742 - 35005692
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| |
|
|
| T |
35005742 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 990090 - 990143
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
990090 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 2939934 - 2939987
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
2939987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 12158692 - 12158745
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
12158692 |
ctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 13260319 - 13260266
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
13260319 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 181 - 226
Target Start/End: Original strand, 13770666 - 13770711
Alignment:
| Q |
181 |
tagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
13770666 |
tagtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
13770711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 16083394 - 16083341
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || ||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgtaa |
16083341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 19623015 - 19622962
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19623015 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 24510311 - 24510258
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
24510311 |
gatggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 24649352 - 24649405
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
24649352 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 26324945 - 26324842
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| |||| || | ||||||||||| |||||||| |||||||| |||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
26324945 |
ctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgtctcgtttt |
26324846 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
26324845 |
ggtt |
26324842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 31258341 - 31258394
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
31258341 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 32420100 - 32420153
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| |||||||||||| |
|
|
| T |
32420100 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 37545630 - 37545683
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||||||| |
|
|
| T |
37545630 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 42483269 - 42483224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| |||| |
|
|
| T |
42483269 |
ctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 45290459 - 45290512
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
45290459 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 45290818 - 45290765
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || || |||||||||| |||||||| |||||||||||| |
|
|
| T |
45290818 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Complemental strand, 45368848 - 45368791
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| |||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45368848 |
actaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45368791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 29 - 86
Target Start/End: Complemental strand, 48730616 - 48730559
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
48730616 |
actaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgtaa |
48730559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 49074051 - 49074006
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
49074051 |
ctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7867355 - 7867299
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
7867355 |
ctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaa |
7867299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12360605 - 12360661
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || |||| |||||| |||||||| |
|
|
| T |
12360605 |
ctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaa |
12360661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 13259990 - 13260046
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13259990 |
ctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaa |
13260046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 15211863 - 15211803
Alignment:
| Q |
23 |
aagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||| |||||||||||||||||| | ||||||||||| |||||||| ||| | |||||| |
|
|
| T |
15211863 |
aagatggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 17130083 - 17130035
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
17130083 |
gactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 18079400 - 18079456
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
18079400 |
ctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaa |
18079456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 19198947 - 19198891
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
19198947 |
ctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaa |
19198891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 19622657 - 19622709
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||| |
|
|
| T |
19622657 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25658016 - 25658072
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
25658016 |
ctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaa |
25658072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26191732 - 26191676
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
26191732 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
26191676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26442565 - 26442621
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
26442565 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
26442621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 29688426 - 29688374
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
29688426 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 83
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 32626531 - 32626587
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
32626531 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
32626587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34002938 - 34002882
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
34002938 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaa |
34002882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 39025379 - 39025328
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||| ||||||||||| |
|
|
| T |
39025379 |
ctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 39303676 - 39303732
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
39303676 |
ctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaa |
39303732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 39747476 - 39747562
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
39747476 |
ctaaaatatggttttggt-cctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaat |
39747562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 42482981 - 42483037
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||| |||||||| |||||| |
|
|
| T |
42482981 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaa |
42483037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 48609238 - 48609294
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || || ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
48609238 |
ctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaa |
48609294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 48609592 - 48609536
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
48609592 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgtaa |
48609536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 52254185 - 52254241
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
52254185 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
52254241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 1811092 - 1811049
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
1811092 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
1811049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 4617091 - 4617146
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||||| |||||||| |||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgtaa |
4617146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 15335292 - 15335237
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
15335237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 18899842 - 18899897
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18899897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 20948757 - 20948812
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||| | |||||||||||||| |
|
|
| T |
20948757 |
ctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 34808200 - 34808255
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaa |
34808255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 39303817 - 39303774
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
39303817 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
39303774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 45638892 - 45638806
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||| | ||| ||| ||||||||||||||||||||| |
|
|
| T |
45638892 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaa |
45638806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 17984335 - 17984389
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
17984335 |
ctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 75
Target Start/End: Complemental strand, 19198876 - 19198842
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
19198876 |
ttttggttcctgcaaatatgcttcgttttggtttt |
19198842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 32906237 - 32906152
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||| ||||||| | |||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtcattgtaaaattcttttgttgtttttggtccctgcaaa |
32906152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 33380066 - 33380108
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
33380066 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
33380108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 41739118 - 41739065
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41739118 |
ctaaaatatggttttagtccctgcaaata---ttcgttttggttttagtccctgtaa |
41739065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 82
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
37 |
atggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 4789639 - 4789586
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| |||||||||| ||||||||||||| || ||||| |||| |||||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgtaa |
4789586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 17984699 - 17984650
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
17984699 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 86
Target Start/End: Original strand, 24509963 - 24510000
Alignment:
| Q |
49 |
cctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctgtaa |
24510000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 36912855 - 36912896
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttga |
71 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
36912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttga |
36912896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 41358486 - 41358441
Alignment:
| Q |
181 |
tagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||| |||||||| |
|
|
| T |
41358486 |
tagtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaat |
41358441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 41358661 - 41358608
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
41358661 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 41881095 - 41881148
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||| |||||||| |||||||| |||||||||||| |
|
|
| T |
41881095 |
ctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 46868575 - 46868522
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| |||||||||||| |
|
|
| T |
46868575 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 48955716 - 48955765
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||| |
|
|
| T |
48955716 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 82
Target Start/End: Complemental strand, 51986503 - 51986462
Alignment:
| Q |
41 |
ttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
51986503 |
ttttggtccctgcaaatatgtttcgttttgattttcgtccct |
51986462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 1159837 - 1159781
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| |||| ||||||| ||| | |||||| ||||||||||||||| |
|
|
| T |
1159837 |
ctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgtaa |
1159781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 4324008 - 4324052
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||||||||| |
|
|
| T |
4324008 |
gtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaata |
4324052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 7818784 - 7818832
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| ||||||| |
|
|
| T |
7818784 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7819101 - 7819045
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
7819101 |
ctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaa |
7819045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 7867131 - 7867187
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
7867131 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
7867187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 16026575 - 16026627
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||| ||||||| ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
16026575 |
ctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 18079658 - 18079618
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttg |
70 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
18079658 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21383106 - 21383162
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
21383106 |
ctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
21383162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21383426 - 21383370
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| | | ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
21383426 |
ctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgtaa |
21383370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 22919975 - 22919919
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
22919975 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaa |
22919919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28507456 - 28507400
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| |||||||||||| || |||| ||||||||||||||| |
|
|
| T |
28507456 |
ctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaa |
28507400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34383242 - 34383186
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||| | |||||| ||||||||||||||| |
|
|
| T |
34383242 |
ctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgtaa |
34383186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 46868228 - 46868284
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| |||| |||| || |||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
46868228 |
ctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgtaa |
46868284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 49073693 - 49073745
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| ||||| ||||| |
|
|
| T |
49073693 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 50428875 - 50428931
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | |||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
50428875 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaa |
50428931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 227
Target Start/End: Complemental strand, 50429031 - 50428987
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||||||||| |
|
|
| T |
50429031 |
gtccctgcaaaatattttgtttttaaaaaaggtccctgcaaaata |
50428987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 189458 - 189553
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| || |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
189458 |
atgatttgcacacgtggcatatgatgattgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcgttgcaaaata |
189553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 61634 - 61687
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
61634 |
ctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 47995 - 48090
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47995 |
atgatttgcacacttgacacttgatgattgaacccatttattagaaaaatagtccctgtaaaatcttttgatttttaaaaaggtccttgcaaaata |
48090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 222958 - 223036
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| |||||||||| || ||| |||||||| ||| ||||||||| |
|
|
| T |
222958 |
cacatgatgagtgaatccatttattagaaaaatagtctatgcaaaatctctttattcttaaaaagatccctgcaaaata |
223036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 47927 - 47980
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
47927 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 48228 - 48173
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||| |||||||| |||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
48173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 167)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 23629032 - 23628937
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23629032 |
atgatttgtacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
23628937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 132 - 225
Target Start/End: Original strand, 19690525 - 19690618
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19690525 |
atgatttgcacacgtggcacatgatggctgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaa |
19690618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 8170023 - 8169928
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
8170023 |
atgatttgcacacgtgacacatgatgactgaactcatttattagaaaaatagtccctgtaaaatcttttgatttttaaaatggtccctgcaaaata |
8169928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 23502307 - 23502402
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
23502307 |
atgatttgcacatgtggcacatgatgactgaacccatttattgaaaaaatagtcccttcaaaatcttttgatttttaaaatggtccttgcaaaata |
23502402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 132 - 214
Target Start/End: Original strand, 18024140 - 18024222
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaagg |
214 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18024140 |
atgatttgcacatgtggcacatgatgcttgaatccatttattaggaaaatagtccctacaaaatcttttgatttttaaaaagg |
18024222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 3414619 - 3414527
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
3414619 |
atttgcacatgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgtaaaata |
3414527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 15442925 - 15443040
Alignment:
| Q |
16 |
caatattaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
15442925 |
caatattaagatggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtgcctctaaattatttttgttgtttttggtccctgcaa |
15443024 |
T |
|
| Q |
116 |
atgtctcattttggtt |
131 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
15443025 |
atgtcacattttggtt |
15443040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 25121367 - 25121273
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
25121367 |
atgatttgcacacgtgacacatgatgactgac-ccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaagtctctgcaaaata |
25121273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 31198745 - 31198840
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
31198745 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgattttaaaaaaggtccctgcaaaata |
31198840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 133 - 227
Target Start/End: Original strand, 15443095 - 15443189
Alignment:
| Q |
133 |
tgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||| |||||| |||||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
15443095 |
tgatctgcacacatgacacatgatgattgaacctatttatttgaaaaatagtccatgtaaaatcttttgatttttaaaaaggttcctgcaaaata |
15443189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 130 - 227
Target Start/End: Complemental strand, 6564817 - 6564720
Alignment:
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||| || ||||||||| |||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6564817 |
ttatgatttgcacacatggaacatgatgactgaacccatttattagaaaaatagtcactgcaaaatcttttgatttttaaaaaggtccctacaaaata |
6564720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 12757802 - 12757725
Alignment:
| Q |
137 |
ttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaagg |
214 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12757802 |
ttgcacatgtgacacatgatgactgaacccatctattagaaaaatagtccctgcaaaattttttgatttttaaaaagg |
12757725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 225
Target Start/End: Original strand, 13617659 - 13617752
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
|||||||||||| ||| |||||||| | |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13617659 |
atgatttgcacacgtggcacatgataactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaa |
13617752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 21994059 - 21993968
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
21994059 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
21993968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 21994270 - 21994179
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
21994270 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
21994179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 17765245 - 17765150
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| |||||| ||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
17765245 |
atgatttgtacacgtgacagatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccttacaaaata |
17765150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 19320897 - 19320992
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
19320897 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttaattttgaaaaaggtcgctgcaaaata |
19320992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 148 - 226
Target Start/End: Original strand, 1007263 - 1007341
Alignment:
| Q |
148 |
acacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1007263 |
acacatgatgaatgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaat |
1007341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 210
Target Start/End: Original strand, 12298948 - 12299026
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaa |
210 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
12298948 |
atgatttgcacacgtggcacatgatgattgaacccatttattagaaaaatagtccctccaaaatcttttgattcttaaa |
12299026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 226
Target Start/End: Original strand, 25137123 - 25137217
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
|||||||||||| ||| ||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25137123 |
atgatttgcacacgtggcacatgatggctaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaat |
25137217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 1007126 - 1007229
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
1007126 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaatatgcctcatttt |
1007225 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
1007226 |
ggtt |
1007229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 6412577 - 6412474
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
6412577 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
6412478 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
6412477 |
ggtt |
6412474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 132 - 217
Target Start/End: Original strand, 24901368 - 24901453
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||||||||| | |||| ||||||||| || |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
24901368 |
atgatttgcacacgtgacacatgataactgaacccatttattagagaaatagtccctgcaaaatctttcgattttgaaaaaggtcc |
24901453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 3968778 - 3968869
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
3968778 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
3968869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 6412446 - 6412355
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
6412446 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
6412355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 20467484 - 20467575
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
20467484 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
20467575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 22543585 - 22543494
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
22543585 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
22543494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 10910834 - 10910739
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| |||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
10910834 |
atgatttacacacgtggcacatgatgactaaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaagctccctgcaaaata |
10910739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 144 - 227
Target Start/End: Complemental strand, 19267788 - 19267705
Alignment:
| Q |
144 |
tgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||| |||||||| | |||| |||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19267788 |
tgtggcacatgataactgaactcatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
19267705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 213
Target Start/End: Complemental strand, 3276224 - 3276143
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaag |
213 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||| || |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
3276224 |
atgatttgcacacgtgacacatgatgtctgaacccatttattagagaaatagtctctgcaaaatcttttgattttgaaaaag |
3276143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 3968635 - 3968750
Alignment:
| Q |
18 |
atattaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa-- |
115 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
3968635 |
atattaagaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaat |
3968734 |
T |
|
| Q |
116 |
atgtctcattttggtt |
131 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3968735 |
atgtctcattttggtt |
3968750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 30479192 - 30479282
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||| || |||||||||||||| |||| ||||||||| |||| ||||||||||||||||| ||||||||||||||||||| | ||||||| |
|
|
| T |
30479192 |
atttgcgcacgtgacacatgatgactgaacccatttattagaaatatagtccctgcaaaatc--ttgatttttaaaaaggtccctacaaaata |
30479282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 3969007 - 3968921
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3969007 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
3968921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 131
Target Start/End: Original strand, 13617529 - 13617634
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatt |
125 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
13617529 |
gactaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaatatgcctcatt |
13617628 |
T |
|
| Q |
126 |
ttggtt |
131 |
Q |
| |
|
|||||| |
|
|
| T |
13617629 |
ttggtt |
13617634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 218
Target Start/End: Complemental strand, 27765044 - 27764958
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcca |
218 |
Q |
| |
|
|||||||||||| |||||||||||| | || |||||||| |||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27765044 |
atgatttgcacacatgacacatgatggctaaactcatttattagaaaaataatccttgcaaaatcttttgatttttaaaaaggtcca |
27764958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 21385253 - 21385356
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
21385253 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtctcatttt |
21385352 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
21385353 |
ggtt |
21385356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 21994401 - 21994298
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||| |||| |
|
|
| T |
21994401 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcttttt |
21994302 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
21994301 |
ggtt |
21994298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 22543716 - 22543613
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
22543716 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
22543617 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
22543616 |
ggtt |
22543613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 1007507 - 1007451
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1007507 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1007451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 1214824 - 1214892
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
1214824 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaatagtccctacaaaatatttt |
1214892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3414389 - 3414445
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3414389 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3414445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 10910962 - 10910875
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10910962 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaat |
10910875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21147406 - 21147462
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
21147406 |
ctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaa |
21147462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25121494 - 25121438
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
25121494 |
ctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaa |
25121438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25137355 - 25137299
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25137355 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25137299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30479420 - 30479364
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30479420 |
ctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaa |
30479364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 7324189 - 7324134
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
7324134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 160 - 227
Target Start/End: Original strand, 13268259 - 13268326
Alignment:
| Q |
160 |
tgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
13268259 |
tgaacccatttattagaaaattagtccctgcaaaattttttaatttttaaaaaggtccctgcaaaata |
13268326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 135 - 222
Target Start/End: Original strand, 21385384 - 21385470
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
||||||||| || |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
21385384 |
atttgcacacatgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgca |
21385470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 22543356 - 22543442
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
22543356 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
22543442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 34990312 - 34990257
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
34990257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 19267567 - 19267621
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
19267567 |
ctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 30037887 - 30037949
Alignment:
| Q |
165 |
ccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||| |||| | ||||||||| |
|
|
| T |
30037887 |
ccatttattagaaaaatagtccctgcaaaatctttcgatttttaaagaggttcctgcaaaata |
30037949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 1890450 - 1890397
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1890450 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 14655381 - 14655434
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||||||| |
|
|
| T |
14655381 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 22822649 - 22822596
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22822649 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 31198617 - 31198720
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||| |||||||| |
|
|
| T |
31198617 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaattttgttgttgtttttggtccctgcaaatatgcctcatttt |
31198716 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
31198717 |
ggtt |
31198720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12299138 - 12299082
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
12299138 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
12299082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 15962387 - 15962331
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
15962387 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
15962331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 17771913 - 17771969
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17771913 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
17771969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19296110 - 19296166
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||| |||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19296110 |
ctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaa |
19296166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19690395 - 19690451
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
19690395 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19690451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25136996 - 25137052
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25136996 |
ctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaa |
25137052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 149 - 225
Target Start/End: Original strand, 31276201 - 31276277
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||| |||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
31276201 |
cacatgatgactgaacccatttattaaaaaaatagtcattgcaaaatcttttgatttttaaaatggtcactgcaaaa |
31276277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 34582531 - 34582587
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
34582531 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34582587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 6412220 - 6412306
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
6412220 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaa |
6412306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 10091039 - 10091094
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
10091094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 194
Target Start/End: Original strand, 15722743 - 15722802
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaa |
194 |
Q |
| |
|
||||||||| |||||||||||| | |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
15722743 |
atttgcacacgtgacacatgataactgaacccatttattagaaaaatagtccctgcaaaa |
15722802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 21385582 - 21385496
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
21385582 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
21385496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 21993789 - 21993875
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21993789 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
21993875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 6468312 - 6468366
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
6468312 |
ctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 14428950 - 14428892
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
14428950 |
gactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgtaa |
14428892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 7156158 - 7156105
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
7156158 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 10910620 - 10910716
Alignment:
| Q |
19 |
tattaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa |
115 |
Q |
| |
|
||||| |||| |||||||||||||||||| || |||||||| |||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10910620 |
tattatgatggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaa |
10910716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 13268111 - 13268214
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| | ||||||||||| ||| | |||||||||||||||||| ||||||| |||| |
|
|
| T |
13268111 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccctataaaaataatttgatgtttttggtccctgcaaatatgtctcgtttt |
13268210 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
13268211 |
ggtt |
13268214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 15076202 - 15076149
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
15076202 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 17765373 - 17765270
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
17765373 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaatttttgttgttgtttttggtccctgcaaatatgcctcatttt |
17765274 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
17765273 |
ggtt |
17765270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 131
Target Start/End: Original strand, 19320765 - 19320872
Alignment:
| Q |
26 |
atgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctca |
123 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || ||||| ||||| ||||||||| |||||||||||||| ||||| ||| |||| |
|
|
| T |
19320765 |
atgactaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaagaattttttgttgtttttggtccttgcaaatatgcctca |
19320864 |
T |
|
| Q |
124 |
ttttggtt |
131 |
Q |
| |
|
|||||||| |
|
|
| T |
19320865 |
ttttggtt |
19320872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 20467716 - 20467663
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
20467716 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 24274129 - 24274076
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
24274129 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 31166872 - 31166925
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
31166872 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 31167198 - 31167145
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
31167198 |
ctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 25 - 86
Target Start/End: Complemental strand, 31186594 - 31186533
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31186594 |
gatggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaa |
31186533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 33801741 - 33801688
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
33801741 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 33808622 - 33808675
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
33808622 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 318095 - 318039
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
318095 |
ctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgtaa |
318039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 494407 - 494463
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
494407 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
494463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||| || |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3276352 - 3276296
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3276352 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3276296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3356144 - 3356200
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3356144 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgtaa |
3356200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 3414750 - 3414663
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
3414750 |
ctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaat |
3414663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12757612 - 12757668
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
12757612 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaa |
12757668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14428652 - 14428708
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14428652 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
14428708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14655905 - 14655961
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
14655905 |
ctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaa |
14655961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 14656258 - 14656202
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
14656258 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
14656202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 15722612 - 15722668
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
15722612 |
ctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaa |
15722668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18024373 - 18024317
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
18024373 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
18024317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 19296405 - 19296349
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
19296405 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
19296349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 19321129 - 19321081
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
19321129 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21995066 - 21995122
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
21995066 |
ctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaa |
21995122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 23628800 - 23628856
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
23628800 |
ctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgtaa |
23628856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 23770163 - 23770219
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
23770163 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
23770219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25431852 - 25431796
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25431852 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25431796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30928683 - 30928739
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30928683 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
30928739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30929042 - 30928986
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30929042 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30928986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 31185764 - 31185832
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| || |||||||||||||||||| |||| |
|
|
| T |
31185764 |
atgatttgcacacgtggcacatgatgactgaactcatttattagagaaatagtccctgcaaaatatttt |
31185832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31276338 - 31276282
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31276338 |
ctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
31276282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 34582890 - 34582834
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
34582890 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
34582834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 82
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 12176640 - 12176585
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12176585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 18024014 - 18024069
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
18024069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 86
Target Start/End: Complemental strand, 13617804 - 13617758
Alignment:
| Q |
40 |
gttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13617758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 34989963 - 34990013
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
34989963 |
ctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 777679 - 777732
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| |||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
777679 |
ctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 7155799 - 7155852
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||| ||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
7155799 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 8170149 - 8170100
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
8170149 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 8680777 - 8680830
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8680777 |
ctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 8681114 - 8681061
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
8681114 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 12419936 - 12419883
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
12419936 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 15962029 - 15962082
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||||||| |
|
|
| T |
15962029 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 34 - 83
Target Start/End: Original strand, 19129342 - 19129391
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19129342 |
aatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 19129518 - 19129415
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| ||||||| |||| |
|
|
| T |
19129518 |
ctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaatatgtctcgtttt |
19129419 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
19129418 |
ggtt |
19129415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 19267910 - 19267809
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | ||||| ||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
19267910 |
ctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaattttttgt--ttgtttttggtccctgcaaatatgtctcatttt |
19267813 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
19267812 |
ggtt |
19267809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 75
Target Start/End: Original strand, 23502239 - 23502284
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
23502239 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 24273830 - 24273883
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
24273830 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 24692977 - 24692924
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
24692977 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 24901241 - 24901290
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
24901241 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 32885675 - 32885728
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
32885675 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 2615874 - 2615926
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
2615874 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 227
Target Start/End: Complemental strand, 6468493 - 6468449
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
6468493 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaata |
6468449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 8169789 - 8169845
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| || |||||||||||| ||||||||| |
|
|
| T |
8169789 |
ctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctgtaa |
8169845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 11449167 - 11449111
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| || |||||||||||| |
|
|
| T |
11449167 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaa |
11449111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11925741 - 11925797
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11925741 |
ctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgtaa |
11925797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12612357 - 12612301
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12612357 |
ctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12612301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 227
Target Start/End: Original strand, 14656035 - 14656120
Alignment:
| Q |
134 |
gatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||||||||||| | |||| |||| |||| |||||||||||| | ||||||||||||||||||||| | ||||||| |
|
|
| T |
14656035 |
gatttgcacatgtgacacatgatcactgaacccatctatt--------agtccctgcaaatttttttgatttttaaaaaggtccctacaaaata |
14656120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 17765011 - 17765059
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
17765011 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21995423 - 21995367
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
21995423 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaa |
21995367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 22792897 - 22792841
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| | || ||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
22792897 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccccgtaa |
22792841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 23502538 - 23502482
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
23502538 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaa |
23502482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 30239295 - 30239347
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
30239295 |
ctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 33131848 - 33131792
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
33131848 |
ctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaa |
33131792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 2373181 - 2373236
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| || ||||||||||| |
|
|
| T |
2373181 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 12176565 - 12176522
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
12176565 |
gtccctgcaaaattttttgttttttaaaaaggtccctgcaaaat |
12176522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 20582792 - 20582749
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
20582792 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
20582749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 23770343 - 23770300
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
23770343 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
23770300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 34990136 - 34990093
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
34990136 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
34990093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 12419710 - 12419760
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||| |
|
|
| T |
12419710 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 14428819 - 14428861
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
14428819 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
14428861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 19690755 - 19690702
Alignment:
| Q |
32 |
aaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg-ttttagtccgtgtaa |
19690702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 21995244 - 21995286
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
21995244 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
21995286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 543722 - 543669
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
543722 |
ctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Complemental strand, 6591441 - 6591392
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||| ||||||| |
|
|
| T |
6591441 |
actaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 322
Target Start/End: Original strand, 22792840 - 22792869
Alignment:
| Q |
293 |
tttacggggactaaaaccaaaacgaggcat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22792840 |
tttacggggactaaaaccaaaacgaggcat |
22792869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 317814 - 317870
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
317814 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgtaa |
317870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 494750 - 494694
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
494750 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
494694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 1214994 - 1214942
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||| ||||||||||| |
|
|
| T |
1214994 |
ctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 6564934 - 6564886
Alignment:
| Q |
38 |
tggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
6564934 |
tggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
6564886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11448539 - 11448595
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || |||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
11448539 |
ctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaa |
11448595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 15117038 - 15116983
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
15117038 |
ctaaaatatggttttagtccctgcaaatatgcctc-ctttgattttagtccatgtaa |
15116983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 15722898 - 15722842
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| | || ||| |||||||| |||||| |
|
|
| T |
15722898 |
ctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtctctgtaa |
15722842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25431578 - 25431634
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| | |||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25431578 |
ctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgtaa |
25431634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 26375695 - 26375751
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
26375695 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaa |
26375751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 262)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 1721217 - 1721312
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
1721217 |
atgatttgcacatgtggcacatgatgagtgaacccatttattagaaaaatagtccctgcaaaatcttttgatttgtaaaaacgtccctgcaaaata |
1721312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 19844396 - 19844491
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
19844396 |
atgatttgcacacgtgacacatgatgagtgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
19844491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 20644635 - 20644730
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
20644635 |
atgatttgcacatgtggcacatgatgagtgaacccatttattagaaaaatagtccctgcaaaatcttttgatttgtaaaaacgtccctgcaaaata |
20644730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 38232478 - 38232383
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
38232478 |
atgatttgtacacgtgacacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaagatccctgcaaaata |
38232383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 120 - 226
Target Start/End: Complemental strand, 16679846 - 16679740
Alignment:
| Q |
120 |
ctcattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccat |
219 |
Q |
| |
|
|||||||| || |||||||||||| ||| |||| ||||| |||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
16679846 |
ctcatttttgtgatgatttgcacacgtggcacaagatgactgaacccatttattagaaaaatagtccctacaaaatcttttgatttttaaaaaggtccct |
16679747 |
T |
|
| Q |
220 |
gcaaaat |
226 |
Q |
| |
|
||||||| |
|
|
| T |
16679746 |
gcaaaat |
16679740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 132 - 216
Target Start/End: Original strand, 35177385 - 35177469
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
216 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35177385 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
35177469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 9262024 - 9261929
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
9262024 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
9261929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 215
Target Start/End: Original strand, 28418671 - 28418754
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28418671 |
atgatttgcacacgtggcacatgatgactgaatccattaattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
28418754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 29686668 - 29686763
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||||| | || ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29686668 |
atgatttgaacacgtggcacatgatgactaaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
29686763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 35407569 - 35407664
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
35407569 |
atgatttgtacaggtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggttcttgcaaaata |
35407664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 35565638 - 35565733
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35565638 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
35565733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 40277952 - 40278047
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40277952 |
atgatttgcacacgtggcacatgatgactgaacccatttattagataaatagtccctacaaaatcttttgatttttaaaaaggtccctgcaaaata |
40278047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 47005284 - 47005379
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47005284 |
atgatttgcacacgtggtacatgatgaccgaacccatttatttaaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
47005379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 52342452 - 52342357
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||| |||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
52342452 |
atgatttgcacacgtggcacatgatgactgaattcatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
52342357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 3387395 - 3387490
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
3387395 |
atgatttgcacacttggcacatgatgagtgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
3387490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 4034847 - 4034942
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
4034847 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctacaaaata |
4034942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 39132777 - 39132694
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39132777 |
atgatttgcacacgtgacgcatgatgactgaactcatttattagaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
39132694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 47114684 - 47114599
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| |||||||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
47114684 |
atgatttgcacacgtgacacatgatgactgaacccatttattagaaaaataatcccagcaaaatcttttgatttttaaaacggtcc |
47114599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 863649 - 863547
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
863550 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
863549 |
gtt |
863547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 22016275 - 22016184
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
22016275 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
22016184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 54608651 - 54608742
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
54608651 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
54608742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 7957097 - 7957002
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| | ||||||| ||||||| || | |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7957097 |
atgatttgcacacgtggcacatgatgactgaaccaatttattagaaaaatggttcttgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
7957002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 8555178 - 8555083
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||| || || |||| | ||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8555178 |
atgatttgcacacgtgtcacacgacgactgaaccaatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
8555083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 9596965 - 9596870
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| | ||| |||||||||| |||| ||||||||| ||||||| |||||||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
9596965 |
atgatttgcatacgtggcacatgatgactgaacccatttattagaaaaatggtccctgcaaaatcttttgattttgaaaaagatccctgcaaaata |
9596870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 25610001 - 25609906
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| |||||||||| |||| ||||||||| |||||| |||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25610001 |
atgatttgaacacgtggcacatgatgactgaacccatttattagaaaaacagtcattgcaaaatcttttgatttttaaaaaggtccctgcaaaata |
25609906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 30034342 - 30034247
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| | |||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
30034342 |
atgatttgcacacgtggcacatgatgactgaaccaatttatcagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
30034247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 44802484 - 44802389
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||| |||| |||| | ||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44802484 |
atgatttgcacacatgacacataatgactgaacctatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaggtctttgcaaaata |
44802389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 53113513 - 53113608
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| || |||||||||| |||| | ||||||| |||||||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
53113513 |
atgatttgcacacatggcacatgatgactgaacctatttattagaaaaatagtccttgcaaaatcttttgatttttaaaaaagtccctgcaaaata |
53113608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 15979340 - 15979443
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
15979340 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
15979439 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
15979440 |
ggtt |
15979443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 47336230 - 47336333
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
47336230 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
47336329 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
47336330 |
ggtt |
47336333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 474275 - 474184
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | |||| ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
474275 |
atttgcacacgtgtcacatgatgacttaatc-atttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
474184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 8940392 - 8940301
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
8940392 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
8940301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 12741040 - 12741131
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
12741040 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
12741131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 15979471 - 15979562
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
15979471 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
15979562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 22008757 - 22008666
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
22008757 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
22008666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 28552250 - 28552159
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||| |||||||||| | || | ||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
28552250 |
atttgcacatgtgtcacatgatgacttaa-ctatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
28552159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45313861 - 45313805
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313861 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaa |
45313805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 47336361 - 47336452
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
47336361 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
47336452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 49324013 - 49323922
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
49324013 |
atttgcacacgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
49323922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 51550215 - 51550306
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
51550215 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
51550306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 53719197 - 53719117
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaa |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||| | ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53719197 |
atgatttgcacacgtgatacatgatgactgaatccattttgtagaaaaatagtccctgcaaaatattttgatttttaaaaa |
53719117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 14772342 - 14772437
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| ||| ||||||||||||||| |||||| | |||||||||||| | |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
14772342 |
atgatttgtacacgtggcacatgatgattgaacccattttgtggaaaaatagtccatacaaaatattttgatttttaaaaaggtccctgcaaaata |
14772437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 215
Target Start/End: Complemental strand, 29678257 - 29678174
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggt |
215 |
Q |
| |
|
|||||||||||| ||| |||| ||||| | || ||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29678257 |
atgatttgcacacgtggcacaagatgactaaacccatttattagaaaaatagtgcctgcaaaatcttttgatttttaaaaaggt |
29678174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 35936995 - 35936900
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||| | ||||||| |||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
35936995 |
atgatttgcacacgtgatagatgatgaatgaacccatttatcagaaaaatagtctctgcaaaatcttttaatttttaaaaaggtctctgcaaaata |
35936900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 129 - 227
Target Start/End: Complemental strand, 46622002 - 46621903
Alignment:
| Q |
129 |
gttatgatttgcacatgtgacacatgatgattgaatc-catttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||| || | |||||||| ||||||||||||||| ||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
46622002 |
gttatgatttgcacacatgacacatgatgactgtcactcatttattagaaaaatagtccctgtaaaatcttttgatttttaaaaaggtccctacaaaata |
46621903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 54767301 - 54767395
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| || |||||||||||||| |||| ||||| ||| ||||| ||||||||||||||| ||||||||||||||||||||| | ||||||| |
|
|
| T |
54767301 |
atgatttgctcacgtgacacatgatgactgaacccattcattagaaaa-tagtccctgcaaaatattttgatttttaaaaaggtccctacaaaata |
54767395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 29490596 - 29490518
Alignment:
| Q |
149 |
cacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
29490596 |
cacatgatgactgaacccatttatttgaaaaatagtccctacaaaatcttttggtttccaaaaaggtccctgcaaaata |
29490518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 136
Target Start/End: Original strand, 51550084 - 51550192
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
51550084 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
51550183 |
T |
|
| Q |
128 |
ggttatgat |
136 |
Q |
| |
|
|||| |||| |
|
|
| T |
51550184 |
ggttttgat |
51550192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 130 - 227
Target Start/End: Complemental strand, 863524 - 863427
Alignment:
| Q |
130 |
ttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||||| || |||||||||| || | ||||||||| | ||||||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
863524 |
ttatgatttgcacacatggcacatgatgactggactcatttatttaagaaatagtccctgcaaaatcttttgattttcaaaaaggttcctgcaaaata |
863427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 9597093 - 9596990
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat--gtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
9597093 |
ctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatacgcctcatttt |
9596994 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
9596993 |
ggtt |
9596990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 22008888 - 22008785
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
22008888 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatttt |
22008789 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
22008788 |
ggtt |
22008785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 26089732 - 26089835
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||| ||||||| |||| |
|
|
| T |
26089732 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcttttt |
26089831 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
26089832 |
ggtt |
26089835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 28552381 - 28552278
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
28552381 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcatttt |
28552282 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
28552281 |
ggtt |
28552278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 29955295 - 29955356
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29955295 |
gatgactaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
29955356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 30004449 - 30004510
Alignment:
| Q |
25 |
gatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30004449 |
gatgactaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
30004510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 54608520 - 54608623
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
54608520 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcatttt |
54608619 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
54608620 |
ggtt |
54608623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 1721450 - 1721394
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1721450 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1721394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 11463234 - 11463290
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11463234 |
ctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaa |
11463290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 32119451 - 32119360
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| | ||||||| |
|
|
| T |
32119451 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctacaaaata |
32119360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 45002154 - 45002245
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
45002154 |
atttgcacacgtggcacatgatgactgaa-ccatttattagataaatagtccctgcaaaatcttttgattttgtaaaagatccctgcaaaata |
45002245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 45006016 - 45006109
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||| || |||||||| |||||||||| |||||||| ||||| || ||||||||||| |
|
|
| T |
45006016 |
atgatttgcacacgtgacacatgatgactgaacccatttattagagaaatagtctctgcaaaatc--ttgattttgaaaaaagttcatgcaaaata |
45006109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 131
Target Start/End: Original strand, 4034709 - 4034822
Alignment:
| Q |
20 |
attaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--at |
117 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
4034709 |
attaatatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatat |
4034808 |
T |
|
| Q |
118 |
gtctcattttggtt |
131 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
4034809 |
gcctcattttggtt |
4034822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 31480138 - 31480224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31480138 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
31480224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 135 - 222
Target Start/End: Original strand, 43441403 - 43441489
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgca |
222 |
Q |
| |
|
||||||||| ||| |||||||||| | || ||||||||| || ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
43441403 |
atttgcacacgtgtcacatgatgacttaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgca |
43441489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 46724778 - 46724683
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||| ||| ||| |||||||||| |||| ||||| ||| ||||||||||| ||||||||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
46724778 |
atgatttaaacacgtgtcacatgatgactgaacccattcattagaaaaatagtctctgcaaaatcttttgatttttgaaaaggtccctccaaaata |
46724683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 49323784 - 49323870
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49323784 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
49323870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 50009050 - 50009145
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||| | || |||||||| |||||||||||| |||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
50009050 |
atgatttgcacacgtggcacatgattaccaaactcatttattagaaaaatagtccatgcaaaatcttttgatttttaaaaaggttcctgcaaaata |
50009145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 132 - 206
Target Start/End: Original strand, 9603759 - 9603833
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
9603759 |
atgatttgcacacgtgtcacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgatttt |
9603833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 12740909 - 12741012
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
12740909 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
12741008 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
12741009 |
ggtt |
12741012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 28452374 - 28452271
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |||||||||||| || ||||||||| |||||||||| |||||||||||| |
|
|
| T |
28452374 |
ctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttagtccctgcaaatatgtctcatttt |
28452275 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
28452274 |
ggtt |
28452271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 31480498 - 31480395
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
31480498 |
ctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatttt |
31480399 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
31480398 |
ggtt |
31480395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 32119582 - 32119479
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
32119582 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
32119483 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
32119482 |
ggtt |
32119479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 2486772 - 2486704
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2486772 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtccctgcaaaatatttt |
2486704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 5345687 - 5345631
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5345687 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
5345631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 8940522 - 8940420
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaactttttgttgtttttgatccctgcaaatatgtctcattttg |
8940423 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
8940422 |
gtt |
8940420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14772213 - 14772269
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
14772213 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcccggtaa |
14772269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25610128 - 25610072
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25610128 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgtaa |
25610072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25615977 - 25616033
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25615977 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25616033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 28418898 - 28418842
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
28418898 |
ctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaa |
28418842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 31480367 - 31480276
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| || |||||| || ||||||||| ||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31480367 |
atttgcacacgtggcacatgatgactgaaccc-tttattagagaaatagtccttgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
31480276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 132 - 200
Target Start/End: Original strand, 36732768 - 36732836
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctttt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
36732768 |
atgatttgcacatgtggcacatgatgactgaacccagttattagaaaaatagtccctgcaaaatatttt |
36732836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 39072211 - 39072155
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
39072211 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaa |
39072155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 9261791 - 9261877
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9261791 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaa |
9261877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 12741269 - 12741183
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12741269 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
12741183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 19844579 - 19844493
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19844579 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19844493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 27681447 - 27681542
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| |||||| |||||| ||| ||||||||| ||||||||||||| ||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
27681447 |
atgatttgcacacgtgacatgtgatgaccgaacccatttattataaaaatagtccctacaaaatcttttaatttttagaaaggtcactgcaaaata |
27681542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 28552023 - 28552109
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28552023 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaa |
28552109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 30106090 - 30105996
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||| ||||| | | |||||||||| |||| ||||| ||| ||||| ||||| ||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
30106090 |
atgattagcacacgcggcacatgatgagtgaacccatt-attagaaaagtagtcgctgcaaaatcttttgatttttaaaaaggtccctccaaaata |
30105996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 45002383 - 45002297
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45002383 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
45002297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 47336579 - 47336493
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336579 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
47336493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 27 - 86
Target Start/End: Original strand, 50196298 - 50196357
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
50196298 |
tgactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50196357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 51550444 - 51550358
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51550444 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaa |
51550358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 54608861 - 54608775
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54608861 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
54608775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 2486902 - 2486844
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
2486902 |
gactaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaa |
2486844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 20405093 - 20405019
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
|||||||||| | |||||||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
20405093 |
atgatttgcatacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaatattttgttttt |
20405019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 474406 - 474303
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| |||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
474406 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatttt |
474307 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
474306 |
ggtt |
474303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 9603631 - 9603734
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| ||||||||||| ||| |||||||||||||||||||| |||||| ||||| |
|
|
| T |
9603631 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctgcaaatatgtcttatttt |
9603730 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
9603731 |
ggtt |
9603734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 28942903 - 28942850
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
28942903 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 45002023 - 45002126
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||| |||| || |||||||||||||||| ||| |||||||||||| |
|
|
| T |
45002023 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctacaaatatgtctcatttt |
45002122 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
45002123 |
ggtt |
45002126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 47005156 - 47005259
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
47005156 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgtctcgtttt |
47005255 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
47005256 |
ggtt |
47005259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 51834940 - 51834887
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||||||| |
|
|
| T |
51834940 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 4513265 - 4513321
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4513265 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4513321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 4950039 - 4950095
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4950039 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4950095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 7957224 - 7957168
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
7957224 |
ctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaa |
7957168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19844267 - 19844323
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
19844267 |
ctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaa |
19844323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 25710868 - 25710812
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
25710868 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25710812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26090076 - 26090020
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
26090076 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26090020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30106218 - 30106162
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
30106218 |
ctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
30106162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40277824 - 40277880
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
40277824 |
ctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaa |
40277880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 45005889 - 45005991
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgcctcattttg |
45005988 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
45005989 |
gtt |
45005991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 48924238 - 48924182
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
48924238 |
ctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
48924182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 49324143 - 49324041
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcattttg |
49324044 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
49324043 |
gtt |
49324041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 9262153 - 9262102
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
9262153 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 10778373 - 10778428
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgtaa |
10778428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 35569133 - 35569078
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35569078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 40370587 - 40370536
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
40370587 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 43441601 - 43441515
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43441601 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
43441515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 47005517 - 47005431
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
47005517 |
ctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaa |
47005431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 52956570 - 52956507
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaat |
195 |
Q |
| |
|
||||||| |||| |||||||||||||| |||| ||||||||| || |||||||||||||||||| |
|
|
| T |
52956570 |
atgatttacacacgtgacacatgatgactgaacccatttattagagaaatagtccctgcaaaat |
52956507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 153 - 227
Target Start/End: Original strand, 19297739 - 19297813
Alignment:
| Q |
153 |
tgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||| |||| || |||||| |||||||| | ||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
19297739 |
tgatgactgaacccttttattagaaaaatatttcctacaaaatcatttgatttttaaaaaggtccctgcaaaata |
19297813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 31869594 - 31869652
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31869594 |
gactaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaa |
31869652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 275446 - 275499
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
275446 |
ctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 474046 - 474099
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
474046 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 3152109 - 3152056
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
3152109 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 10976980 - 10977033
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10976980 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 20611022 - 20611071
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
20611022 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 20612896 - 20612843
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
20612896 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 22155931 - 22155984
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22155931 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 22156291 - 22156238
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
22156291 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 25710515 - 25710568
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25710568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 28427247 - 28427300
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
28427247 |
ctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 28427606 - 28427553
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
28427606 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 35565510 - 35565613
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||| | ||||||||||| | |||||||| ||||||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
35565510 |
ctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattttttgttattgtttttggtccctgcaaatatgcctcatttt |
35565609 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
35565610 |
ggtt |
35565613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 37506869 - 37506922
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37506869 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 37507220 - 37507167
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
37507220 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 39437107 - 39437054
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
39437107 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 40169652 - 40169599
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40169652 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 191
Target Start/End: Complemental strand, 40370468 - 40370399
Alignment:
| Q |
122 |
cattttggttatgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgca |
191 |
Q |
| |
|
|||||| || |||||||||||| ||| |||||||||| |||| ||||||||| || |||||||||||||| |
|
|
| T |
40370468 |
catttttgtgatgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtccctgca |
40370399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 43441272 - 43441371
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||| |||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
43441272 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatttt |
43441371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 46622127 - 46622074
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||| |||||||||||| |
|
|
| T |
46622127 |
ctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 51834610 - 51834663
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
51834610 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 3151752 - 3151804
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3151752 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 31 - 131
Target Start/End: Original strand, 3387268 - 3387370
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| |||||||||||| || |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgaaaaaaaaatttgttgtttttggtccctgcaaatatgcctcattttg |
3387367 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
3387368 |
gtt |
3387370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3387602 - 3387546
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3387602 |
ctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgtaa |
3387546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3830136 - 3830192
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
3830136 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
3830192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3830514 - 3830458
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3830514 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
3830458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4035051 - 4034995
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
4035051 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgtaa |
4034995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 9596760 - 9596816
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9596760 |
ctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaa |
9596816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 9863402 - 9863346
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9863402 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
9863346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 15979699 - 15979643
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
15979699 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
15979643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19656543 - 19656599
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
19656543 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaa |
19656599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20405221 - 20405165
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
20405221 |
ctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaa |
20405165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 20644507 - 20644563
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
20644507 |
ctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaa |
20644563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 20644874 - 20644818
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
20644874 |
ctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaa |
20644818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21159455 - 21159511
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21159455 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
21159511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 21159815 - 21159759
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
21159815 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
21159759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 21553891 - 21553947
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
21553891 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaa |
21553947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22008528 - 22008584
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
22008528 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22008584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 22016046 - 22016102
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
22016046 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22016102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29445956 - 29446012
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29445956 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29446012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29490741 - 29490685
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
29490741 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
29490685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30268507 - 30268563
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30268507 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30268563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 38232243 - 38232299
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
38232243 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaa |
38232299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 40545566 - 40545622
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40545566 |
ctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
40545622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 44802284 - 44802340
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
44802284 |
ctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaa |
44802340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 29 - 116
Target Start/End: Complemental strand, 45006248 - 45006161
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||| |||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
45006248 |
actaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
45006161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 45320977 - 45320921
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45320977 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45320921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 46186411 - 46186467
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
46186411 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaa |
46186467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 46724900 - 46724844
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
46724900 |
ctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgtaa |
46724844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 50009282 - 50009226
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||| |||||||||||| | ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
50009282 |
ctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaa |
50009226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 51759821 - 51759877
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| | ||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
51759821 |
ctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaa |
51759877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 53701661 - 53701605
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
53701661 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 8555305 - 8555250
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaa |
8555250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 9603917 - 9603831
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
9603917 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgtaaaagaaatttgttgtttttggtccctgcaaa |
9603831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 14633545 - 14633600
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
14633545 |
gactaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 16123141 - 16123196
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
16123141 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 30426224 - 30426174
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccc |
81 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
30426224 |
ctaaaatatggttttagt-cctgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35936782 - 35936868
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||| ||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
35936782 |
ctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaatttttttttgttgtttttggtccctgcaaa |
35936868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 54767524 - 54767469
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaa |
54767469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 8940163 - 8940248
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||| | |||||||||| | |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8940248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 15016390 - 15016444
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
15016390 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 116
Target Start/End: Original strand, 30034106 - 30034195
Alignment:
| Q |
27 |
tgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||||||||| | || |||||||| |||||||| ||||| ||| ||||| ||||||||||||||||||||| |
|
|
| T |
30034106 |
tgactaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaa |
30034195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 80
Target Start/End: Complemental strand, 34238913 - 34238863
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || || ||||||||||||||||||| ||||||||| |
|
|
| T |
34238913 |
ctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 49670801 - 49670747
Alignment:
| Q |
30 |
ctaaaatatggttttggttcc-tgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || || |||||||||||||||||||| |||||||||||| |
|
|
| T |
49670801 |
ctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 8510216 - 8510269
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| || ||||| |||||||||||| |
|
|
| T |
8510216 |
ctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 11463479 - 11463376
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcatttt |
127 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||| |||||||| |||||||| |||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
11463479 |
ctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgcctcatttt |
11463380 |
T |
|
| Q |
128 |
ggtt |
131 |
Q |
| |
|
|||| |
|
|
| T |
11463379 |
ggtt |
11463376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 13584365 - 13584312
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||||||| |
|
|
| T |
13584365 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 15286158 - 15286207
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |||||||| |
|
|
| T |
15286158 |
ctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 26799890 - 26799943
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||| |||||||||||| |
|
|
| T |
26799890 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 29955661 - 29955608
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
29955608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 30004816 - 30004763
Alignment:
| Q |
33 |
aaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
30004763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 39288896 - 39288843
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
39288896 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 39436720 - 39436773
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
39436720 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 40169346 - 40169399
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40169346 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 51500683 - 51500630
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||| | || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
51500683 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4513618 - 4513562
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4513618 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
4513562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 7588320 - 7588376
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| | |||||| |||||||| |||||| |
|
|
| T |
7588320 |
ctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgtaa |
7588376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12673646 - 12673702
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
12673646 |
ctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaa |
12673702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 27681680 - 27681624
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
27681680 |
ctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaa |
27681624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 29678026 - 29678082
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29678026 |
ctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
29678082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 29686550 - 29686633
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||| | |||||||||| | |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29686550 |
aatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaatatttttttgttgtttttggtccctgcaaat |
29686633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30034470 - 30034414
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | | |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30034470 |
ctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaa |
30034414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30128286 - 30128342
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||| ||||||| ||||||| |
|
|
| T |
30128286 |
ctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaa |
30128342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 30130160 - 30130216
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
30130160 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
30130216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31869954 - 31869898
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31869954 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
31869898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 39132904 - 39132848
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| | ||| ||| ||||||||||| |
|
|
| T |
39132904 |
ctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgtaa |
39132848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 46186769 - 46186713
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
46186769 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaa |
46186713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 46751273 - 46751329
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
46751273 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
46751329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 50196655 - 50196599
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
50196655 |
ctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaa |
50196599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 52342581 - 52342525
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
52342581 |
ctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaa |
52342525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 1721092 - 1721147
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| | |||||||||| || ||||| ||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaa |
1721147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 3830310 - 3830353
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
3830310 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
3830353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 4322186 - 4322131
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||| |||||||| |||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
4322131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 5048195 - 5048238
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
5048195 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
5048238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 13514575 - 13514520
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgta |
85 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
13514575 |
ctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgta |
13514520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 15016568 - 15016525
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
15016568 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
15016525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 20124847 - 20124890
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
20124847 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
20124890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||| |||| || ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 26089863 - 26089933
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttt |
206 |
Q |
| |
|
||||| ||| ||| |||||||||| |||| ||||||||| || |||||||||||||||||| ||||| |||| |
|
|
| T |
26089863 |
atttgtacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatattttgttttt |
26089933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 28452149 - 28452235
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||||| | |||||||||| | |||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
28452149 |
ctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaa |
28452235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 30268661 - 30268704
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
30268661 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
30268704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 32119222 - 32119308
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||| |||||||| |||||||||||| ||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32119222 |
ctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaa |
32119308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 186 - 217
Target Start/End: Original strand, 35533451 - 35533482
Alignment:
| Q |
186 |
cctgcaaaatcttttgatttttaaaaaggtcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35533451 |
cctgcaaaatcttttgatttttaaaaaggtcc |
35533482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 35937121 - 35937066
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
35937121 |
taaaatatggtttcggttattgaaaatatgcttcgttttagttttagtccctgtaa |
35937066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 40370287 - 40370373
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
40370287 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaa |
40370373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 40545836 - 40545781
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||||| |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
40545781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 46186591 - 46186548
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
46186591 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
46186548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 31 - 86
Target Start/End: Original strand, 51058593 - 51058648
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| || |||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctgtaa |
51058648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 53701538 - 53701581
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
53701538 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
53701581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 14772525 - 14772467
Alignment:
| Q |
28 |
gactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||| || | ||||||||| | || ||||| ||||||||||||||| |
|
|
| T |
14772525 |
gactaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgtaa |
14772467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 29490377 - 29490427
Alignment:
| Q |
36 |
tatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgtaa |
29490427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 30552323 - 30552365
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
30552323 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
30552365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 34238600 - 34238650
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| |
|
|
| T |
34238600 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 52342197 - 52342243
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||| ||||| |
|
|
| T |
52342197 |
ctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 3361816 - 3361767
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||| |
|
|
| T |
3361816 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 10977339 - 10977286
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||| ||| | ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10977339 |
ctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 185
Target Start/End: Complemental strand, 11463351 - 11463298
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtc |
185 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| || |||||||| |
|
|
| T |
11463351 |
atgatttgcacacgtggcacatgatgactgaacccatttattagagaaatagtc |
11463298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 226
Target Start/End: Original strand, 14783928 - 14783969
Alignment:
| Q |
185 |
ccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
14783928 |
ccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
14783969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || | || ||||||||||||||||| |||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
|||||||||||||| || ||||||||||| | || ||||||||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 86
Target Start/End: Complemental strand, 33794785 - 33794748
Alignment:
| Q |
49 |
cctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
33794785 |
cctgcaaatatgcctcgttttaattttagtccctgtaa |
33794748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 39288575 - 39288624
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||| |
|
|
| T |
39288575 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 86
Target Start/End: Original strand, 40560495 - 40560532
Alignment:
| Q |
49 |
cctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
40560495 |
cctgcaaatatgcctcgttttaattttagtccctgtaa |
40560532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 47114489 - 47114538
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
47114489 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 75
Target Start/End: Original strand, 53113445 - 53113490
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttt |
75 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
53113445 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 275831 - 275783
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||| |||| || |||| ||||||||||||||||| ||||||| |
|
|
| T |
275831 |
ctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 4814896 - 4814845
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||||| |
|
|
| T |
4814896 |
ctaaaatatggttttagt-cctgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 7518092 - 7518148
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||| || || ||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
7518092 |
ctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
7518148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 20404892 - 20404940
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||| || ||||||| |
|
|
| T |
20404892 |
ctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 25609769 - 25609825
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| | |||||| || |||||||| ||||||||||||||| |
|
|
| T |
25609769 |
ctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaa |
25609825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 28942527 - 28942575
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||| |
|
|
| T |
28942527 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 29446204 - 29446148
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
29446204 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
29446148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 35177257 - 35177305
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
35177257 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35407788 - 35407732
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | |||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
35407788 |
ctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaa |
35407732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 35498418 - 35498474
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||| ||| || ||| |||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
35498418 |
ctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgtaa |
35498474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 38232594 - 38232542
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| ||| |||| |||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgtaa |
38232542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 39132562 - 39132598
Alignment:
| Q |
48 |
tcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39132562 |
tcctgcaaatatgtttcgttttggttttagtccctgt |
39132598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 40979708 - 40979652
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
40979708 |
ctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgtaa |
40979652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 45313502 - 45313550
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
|||||||||| ||||||| | || ||||||| ||||||||||||||||| |
|
|
| T |
45313502 |
ctaaaatatgattttggtccttgtaaatatgattcgttttgattttagt |
45313550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 82
Target Start/End: Original strand, 50008926 - 50008974
Alignment:
| Q |
34 |
aatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||| ||||||||||| |
|
|
| T |
50008926 |
aatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 50261934 - 50261878
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||| ||||| |||||||| |||||| |
|
|
| T |
50261934 |
ctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgtaa |
50261878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 2425 - 2520
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||||||| |||||||||| |||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
2425 |
atgatttgcacacgtggcacatgatgactgaacccatttattagaaaaatagtgcctgcaaaatcttttgatttttaaaaaggtgcctgcaaaata |
2520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 2658 - 2606
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||| ||||||||||| |
|
|
| T |
2658 |
ctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 21820 - 21915
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||| | ||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
21820 |
atgatttgcacacgtggcacgtgatgattgaaccaatttattagaaaaatagtccctgcaaaatcttttgattttaaaaaaggtccctgcaaaata |
21915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 22053 - 21997
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||| |||||||| ||||||||| ||||| |
|
|
| T |
22053 |
ctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaa |
21997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 132 - 227
Target Start/End: Complemental strand, 34955 - 34861
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| ||||||||| || ||||||| |||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
34955 |
atgatttgcatatgtgacacatgatgactgaacccatttattagataaatagt-cctgcaaaatcttttgatttttaaaaaggttcctgcaaaata |
34861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 34724 - 34809
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
34724 |
taaaatatggttttgtttcctgcaaatatgcttcattttgattttaattcctgtaatttttttttgttgtttttggtccctgcaaa |
34809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 35082 - 35026
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||| | | | |||||||| |||||||| ||||||||||||||| |
|
|
| T |
35082 |
ctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaa |
35026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 75631 - 75540
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
75631 |
atttgcacacgtgtcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
75540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 75762 - 75675
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
75762 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaat |
75675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 75361 - 75447
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
75361 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
75447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 135 - 227
Target Start/End: Original strand, 2635 - 2727
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2635 |
atttgcacacgtggcacatgatgactgaactcatttattagataaatagtccctgcaaaatcttttgatttttaaaaaggtctctgcaaaata |
2727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 2503 - 2555
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
2503 |
ctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 16 - 82
Target Start/End: Complemental strand, 2895 - 2829
Alignment:
| Q |
16 |
caatattaagatgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccct |
82 |
Q |
| |
|
|||||||| ||| |||||||||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
2895 |
caatattaccatggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 52; Significance: 8e-21; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 82471 - 82566
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| | || | |||||| || ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
82471 |
atgatttgcacacgtggcacatgatgactaaaccaatttataagagaaatagtccctgcaaaatcttttgattttgaaaaaggtccctgcaaaata |
82566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 82704 - 82648
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
82704 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
82648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 82343 - 82430
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaat |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
82343 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaat |
82430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 148017 - 148112
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||| ||||| ||| || ||||||||| ||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
148017 |
atgatttgcacacgtggcacatgatgactgaacccattgattagagaaatagtccatgcaaaatcttttgattttgaaaaagatccctgcaaaata |
148112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 148280 - 148224
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
148280 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
148224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 154 - 227
Target Start/End: Original strand, 27151 - 27224
Alignment:
| Q |
154 |
gatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
||||| |||| ||||| ||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
27151 |
gatgactgaacccattcattagaaaaatagtccctgcaaaatcttttgagttttaaaaaggtccctgcaaaata |
27224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 27362 - 27306
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
27362 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 5e-19; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 49945 - 49854
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
49945 |
atttgcacgcgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
49854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 135 - 227
Target Start/End: Complemental strand, 55046 - 54955
Alignment:
| Q |
135 |
atttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaata |
227 |
Q |
| |
|
|||||||| ||| |||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
55046 |
atttgcacgcgtggcacatgatgactgaa-ccatttattagagaaatagtccctgcaaaatcttttgattttgtaaaaggtccctgcaaaata |
54955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 50075 - 49973
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccttgcaaatatgtctcattttg |
49976 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
49975 |
gtt |
49973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 55176 - 55074
Alignment:
| Q |
31 |
taaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaa--atgtctcattttg |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||| || |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccttgcaaatatgtctcattttg |
55077 |
T |
|
| Q |
129 |
gtt |
131 |
Q |
| |
|
||| |
|
|
| T |
55076 |
gtt |
55074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 54817 - 54903
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaannnnnnnnngttgtttttggtccctgcaaa |
116 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54817 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
54903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 137 - 216
Target Start/End: Original strand, 3885 - 3964
Alignment:
| Q |
137 |
ttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatcttttgatttttaaaaaggtc |
216 |
Q |
| |
|
||||||| ||| |||||||||| |||| |||||||| || ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3885 |
ttgcacacgtggcacatgatgactgaactcatttattagagaaatagtccctgcaaaatcttttgattttgaaaaaggtc |
3964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3754 - 3810
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
3754 |
ctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaa |
3810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 26 - 86
Target Start/End: Original strand, 8730 - 8790
Alignment:
| Q |
26 |
atgactaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8730 |
atgactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 9026 - 8970
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9026 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 2780 - 2836
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2780 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3916 - 3860
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3916 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 3534 - 3590
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
3534 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 3741 - 3698
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
3741 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
3698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 366271 - 366215
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
366271 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
366215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 365981 - 366037
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | | ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
365981 |
ctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaa |
366037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Complemental strand, 366097 - 366055
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaa |
225 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
366097 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaa |
366055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 132 - 198
Target Start/End: Original strand, 7075 - 7141
Alignment:
| Q |
132 |
atgatttgcacatgtgacacatgatgattgaatccatttatttgaaaaatagtccctgcaaaatctt |
198 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||| |||||||||| ||||||||||||| |
|
|
| T |
7075 |
atgatttgcacatgtgacacatgatgacggaactcagttattagaaaaatagttcctgcaaaatctt |
7141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 14699 - 14753
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
14699 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 15010 - 14954
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
15010 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
14954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5211 - 5267
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
5211 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 5231 - 5287
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
5231 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 8332 - 8388
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8332 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 8640 - 8584
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8640 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12184 - 12240
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12184 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 12534 - 12478
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
12534 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
12478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 1313 - 1366
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
1313 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 1642 - 1589
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| ||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1642 |
ctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 8549 - 8602
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| |||| || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
8549 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 287 - 234
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||||||||| |
|
|
| T |
287 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 34933 - 34986
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||||| || || ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
34933 |
ctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 4310 - 4254
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||||| ||| ||||| ||||| |
|
|
| T |
4310 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaa |
4254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
35 |
atatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
|||||||||| || ||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 12527 - 12583
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
12527 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
12583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 3289 - 3233
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3289 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
3233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 18041 - 17985
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
18041 |
ctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaa |
17985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 17964 - 17908
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||||||||||||| |||||| | ||| ||||||||||| |
|
|
| T |
17964 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
17908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 94059 - 94115
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || ||| ||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
94059 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaa |
94115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Complemental strand, 11239 - 11196
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
11239 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
11196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 226
Target Start/End: Original strand, 33113 - 33156
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaaaat |
226 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
33113 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaaaat |
33156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 4043 - 4093
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| |
|
|
| T |
4043 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 19225 - 19275
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| ||||||||| |
|
|
| T |
19225 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 24374 - 24428
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgt |
84 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
24374 |
ctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 48 - 86
Target Start/End: Complemental strand, 24638 - 24600
Alignment:
| Q |
48 |
tcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24638 |
tcctacaaatatgcctcgttttgattttagtccctgtaa |
24600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 10170 - 10220
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtcc |
80 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| ||||||||| |
|
|
| T |
10170 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 10513 - 10457
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctgtaa |
86 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| ||||||| ||||||| |
|
|
| T |
10513 |
ctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
10457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 44204 - 44158
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgatttta |
76 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
44204 |
ctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 78
Target Start/End: Original strand, 17125 - 17174
Alignment:
| Q |
29 |
actaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| || |||||| ||||||| |
|
|
| T |
17125 |
actaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 5401 - 5450
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtc |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||||| | |||||| |||||||| |
|
|
| T |
5401 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 5706 - 5653
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagtccctg |
83 |
Q |
| |
|
||||||||||||||| || |||||||||||| | |||||| |||||||||||| |
|
|
| T |
5706 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0428 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0428
Description:
Target: scaffold0428; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 7681 - 7721
Alignment:
| Q |
183 |
gtccctgcaaaatcttttgatttttaaaaaggtccatgcaa |
223 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
7681 |
gtccctgcaaaatattttgttttttaaaaaggtccctgcaa |
7721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 3453 - 3405
Alignment:
| Q |
30 |
ctaaaatatggttttggttcctgcaaatatgcttcgttttgattttagt |
78 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
3453 |
ctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University