View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_18 (Length: 299)
Name: NF11878_low_18
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 51 - 248
Target Start/End: Complemental strand, 41697738 - 41697541
Alignment:
| Q |
51 |
ctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697738 |
ctggggagcttccaagctctgcatttgcatttaatagcaatggattggtaaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaa |
41697639 |
T |
|
| Q |
151 |
gaacaaaattttctttatgatcattaggcattcactctaaattcagtaccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcat |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697638 |
gaacaaaatttgctttatgatcattaggcattcactctaaattcagtaccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcat |
41697541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University