View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_24 (Length: 282)
Name: NF11878_low_24
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 38460504 - 38460249
Alignment:
| Q |
19 |
taatctaagtaaccccccaatttcatataaatacacaagaatgcacaagatagatttttacatcaattaaatccttgctagataaaatgatatctttttt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38460504 |
taatctaagtaaccccc-aatttcatataaatacacaagaatgcacaagatagatttttacatcaattaaatccttgctagataaaatgatatctttttt |
38460406 |
T |
|
| Q |
119 |
gtctcataagttatttcaaattcaaatagtttgtcgttggaatgatggacctcaatcttgtggtctcttaacagaactaacattcatatagattagtagt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38460405 |
gtctcataagttatttcaaattcaaatagtttgtcattggaatgatggacctcaagcttgtgctctcttaacagaactaaccttcatatagattagtagt |
38460306 |
T |
|
| Q |
219 |
cttaaaagtttccttgaatctcaaattatataatctcataataagaaatctgtgctc |
275 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38460305 |
ctcaaaagtttccttgaatctcaaattatataatctcataataagaaatctgtgctc |
38460249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University