View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_29 (Length: 238)
Name: NF11878_low_29
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9301169 - 9301393
Alignment:
| Q |
1 |
gctagctgaacaacttattgtgaagcacattcctgctgatgaccaatgggaagatattcttaccaagtctatttccagtaccaagttt---tccttacta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
9301169 |
gctagctgaacaacttattgtgaagcacattcctgctgatgaccaatgggcagatattcttaccaagtctatttccagtgccaagtttctttccttacta |
9301268 |
T |
|
| Q |
98 |
gtagtggaatgcaacataattgtaatagaacagaaaatcaatgaaaaattgtttgacactttctctcaaattctaacaatccaagtgtcctcggttgctt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9301269 |
gtagtggaatgcaacataattgtaatagaacagaaaatcaatgaaaaattgtttgacactttctctcaaattctaacaatccaagtgtcctcggttgctt |
9301368 |
T |
|
| Q |
198 |
ggatagttgtttttgtcattgaatt |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9301369 |
ggatagttgtttttgtcattgaatt |
9301393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University