View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_32 (Length: 205)
Name: NF11878_low_32
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 22 - 162
Target Start/End: Complemental strand, 24850438 - 24850298
Alignment:
| Q |
22 |
ctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcacacactgcagctgtgctgttttctcaacctgaagcagctgtgcttcgtgcat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
24850438 |
ctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcacacactgcagctgtgctgttgtctcaacctgaagcagctgtgcttcgtgaat |
24850339 |
T |
 |
| Q |
122 |
cgggagaaaaactcctttcccatatcagatcaagaatctga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850338 |
tgggagaaaaactcctttcccatatcagatcaagaatctga |
24850298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University