View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_33 (Length: 204)
Name: NF11878_low_33
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 98 - 187
Target Start/End: Original strand, 39077774 - 39077864
Alignment:
| Q |
98 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatac-tttttctgaagctgaaaataacccttaattctaccacttat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077774 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatacttttttctgaagctgaaaataacccttaattctaccacttat |
39077864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 47
Target Start/End: Original strand, 39077679 - 39077724
Alignment:
| Q |
2 |
cttgcttgttgataatgacaaccactgagagtttgattctttcttc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077679 |
cttgcttgttgataatgacaaccactgagagtttgattctttcttc |
39077724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University