View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11878_low_33 (Length: 204)

Name: NF11878_low_33
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11878_low_33
NF11878_low_33
[»] chr2 (2 HSPs)
chr2 (98-187)||(39077774-39077864)
chr2 (2-47)||(39077679-39077724)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 98 - 187
Target Start/End: Original strand, 39077774 - 39077864
Alignment:
98 ctcttctaattgatgttggatttcttatagaatttcttcatgtggatac-tttttctgaagctgaaaataacccttaattctaccacttat 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
39077774 ctcttctaattgatgttggatttcttatagaatttcttcatgtggatacttttttctgaagctgaaaataacccttaattctaccacttat 39077864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 47
Target Start/End: Original strand, 39077679 - 39077724
Alignment:
2 cttgcttgttgataatgacaaccactgagagtttgattctttcttc 47  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
39077679 cttgcttgttgataatgacaaccactgagagtttgattctttcttc 39077724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University