View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11878_low_7 (Length: 404)
Name: NF11878_low_7
Description: NF11878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11878_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 391
Target Start/End: Complemental strand, 48494886 - 48494519
Alignment:
| Q |
18 |
ctagttcttcaaatgaatgattgattagtgtcacatgcacatcagaattcataagtttgttgaaataacaacttttggnnnnnnnattctacttaggaaa |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48494886 |
ctagttcttcaaatgaatgatt----agtgtcacatgcacatcagaattcataagtttgttgaaataacaacttttggtttttttattctacttaggaaa |
48494791 |
T |
|
| Q |
118 |
attcaaattgtcttttataactttgttattggtaaaaaagtatccatgagctttactgataactaatctcccgacttccgtagagaatctggttggccac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48494790 |
attcaaattgtcttttataactttgttattggtaaaaaagtatccatgagctttactgataactaatctcccgacttccgtagagaatctggttggccac |
48494691 |
T |
|
| Q |
218 |
ccttagtgaaatcatgcatcccaaccacattttttccatttacgaggtttggagacccgaagccttgctctaggatccgagtccaattccaataagatca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48494690 |
ccttagtgaaatcatgcatcccaaccacattttttccattcatgaggtttggagacccgaagccttgctctaggatccgagtccaattccaataagatca |
48494591 |
T |
|
| Q |
318 |
aaataatgttggtagacaaaatcattttgatgttagattattatttttacatgattttagaattttgatgttct |
391 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48494590 |
aaataatgttggtagacaaaatcattt--atgttagattattatttttacatgattttagaattttgatgttct |
48494519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University