View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11879_high_10 (Length: 231)
Name: NF11879_high_10
Description: NF11879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11879_high_10 |
 |  |
|
| [»] scaffold1686 (1 HSPs) |
 |  |
|
| [»] scaffold1452 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold1686 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold1686
Description:
Target: scaffold1686; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 462 - 692
Alignment:
| Q |
1 |
tagtgagatacttttatttaaaacttcgtgtatcacatcagaaaagccgaatccattatgatctattacaatttgaaataatatgtggaaaataatagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
462 |
tagtgagatacttttatttaaaacttcgtgtatcacatcagaaaagccgaatccattatgatctattacaatttgaaataatatgtggaaaataatagat |
561 |
T |
 |
| Q |
101 |
gctaaactcgatgaattgatatggttaatgactattggaggtaggtaggttggagttagatactaccatccttaagtattggtaaattatggcttttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
562 |
gctaaactcgatgaattgatatggttaatgactattggaggtaggtaggttgaagttagatactaccatccttaagtattggtaaattatggtttttcaa |
661 |
T |
 |
| Q |
201 |
cactactctaaaatgtattgttattgctctc |
231 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
662 |
cactactctaaaatgtattgttatttctctc |
692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1452 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1452
Description:
Target: scaffold1452; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 231
Target Start/End: Complemental strand, 1022 - 969
Alignment:
| Q |
178 |
attggtaaattatggcttttcaacactactctaaaatgtattgttattgctctc |
231 |
Q |
| |
|
||||||||||||||||| || | ||||| |||||||||||||||| || ||||| |
|
|
| T |
1022 |
attggtaaattatggctctttagcactattctaaaatgtattgttgtttctctc |
969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University