View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11879_high_5 (Length: 323)
Name: NF11879_high_5
Description: NF11879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11879_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 488281 - 487980
Alignment:
| Q |
1 |
gctaatgattgcagtaggtgtctactaagtgctattggagatataccaggttgctgttatgcctccattggtgcgagagttatgagtcgtagctgttatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
488281 |
gctaatgattgcagtaggtgtctactaagtgctattggagatataccaggttgctgttatgcctccattggtgcgagagttatgagtcgcagctgttatc |
488182 |
T |
|
| Q |
101 |
tgagatatgaattctatccattttatcttggtgaaaaagaacaaacaaagtcttctaccaacctaggagggaaaagtaagcatttctcaagttgcaatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488181 |
tgagatatgaattctatccattttatcttggtgaaaaagaacaaacaaagtcttctaccaacctaggagggaaaagtaagcatttctcaagttgcaatac |
488082 |
T |
|
| Q |
201 |
aattcttaaacattctgtcaaagctagttttgattgatcttttgtgcagataattcaagcaaaatatggatgattacagtcattgcagttggggtaggct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488081 |
aattcttaaacattctgtcaaagctagttttgattgatcttttgtgcagataattcaagcaaaatatggatgattacagtcattgcagttggggtaggct |
487982 |
T |
|
| Q |
301 |
tg |
302 |
Q |
| |
|
|| |
|
|
| T |
487981 |
tg |
487980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University