View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11879_low_11 (Length: 264)
Name: NF11879_low_11
Description: NF11879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11879_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 39946279 - 39946021
Alignment:
| Q |
1 |
catcaagacgggaaaagcaccattttttctcacacacagatggataaatccggacagaaaggtgttttcccgtccgaatggataaatccagtcaggagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39946279 |
catcaagacgggaaaagcaccattttttctcacacacagatggataaatccggacaaaaaggtgttttcccgtccgaatggataaatccagtcaggagca |
39946180 |
T |
 |
| Q |
101 |
gtttttaagaatcatgggggaagaagctccaattatccacacgtcaagccctatagtgttaggcgtgaaggtgcaattcttaggataaaccgaattccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39946179 |
gtttttaagaatcatgggggaagaagctccacttatccacacgtcaagccctatagtgttaggcgtgaaggtgcaattcttagaataaaccgaattccca |
39946080 |
T |
 |
| Q |
201 |
cattggcaaagatgaggtctgggtttggtctgaacatgcatgtccagttctctgcttct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
39946079 |
cattggcaaagatgaggtctgggtttggtccgaacatgcatgtccagttctctgtttct |
39946021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University